Author: Chu, Ruiyin; Reczek, David; Brondyk, William
Title: Capture-stabilize approach for membrane protein SPR assays Document date: 2014_12_8
ID: ueofl0wn_17
Snippet: Capture-stabilize CD52 virus-like particles (VLP). Full-length CD52 coding sequence (ATGAAGCGCTTCCTCTTCCTCCTACTCACCA TCAGCCTCCTGGTTATGGTACAGATACAAACTGGACTCTCAGGACAAA-ACGACACCAGCCAAACCAGCAGCCCCTCAGCATCCAGCAGCATGAGCG-GAGGCATTTTCCTTTTCTTCGTGGCCAATGCCATAATCCACCTCTTCT-GCTTCAGTTGA) was cloned into pEF_DEST51 vector (Invitrogen). Following the user guide for MembranePro TM Functional Protein Expression System from Life Technologies, CD52 VLP prep was ob.....
Document: Capture-stabilize CD52 virus-like particles (VLP). Full-length CD52 coding sequence (ATGAAGCGCTTCCTCTTCCTCCTACTCACCA TCAGCCTCCTGGTTATGGTACAGATACAAACTGGACTCTCAGGACAAA-ACGACACCAGCCAAACCAGCAGCCCCTCAGCATCCAGCAGCATGAGCG-GAGGCATTTTCCTTTTCTTCGTGGCCAATGCCATAATCCACCTCTTCT-GCTTCAGTTGA) was cloned into pEF_DEST51 vector (Invitrogen). Following the user guide for MembranePro TM Functional Protein Expression System from Life Technologies, CD52 VLP prep was obtained. After activation of the C1 chip surface by standard NHS/EDC procedure, the anti-CD52 antibody Alemtuzumab was immobilized and CD52 VLPs were then captured by the anti-CD52 antibody at 1300 RU level. The captured VLPs were further stabilized by limited crosslinking using 20 mM NHS/5 mM EDC for 7 min at flow rate of 5 ml/min and excess crosslinkers were quenched by injection of 1 M ethanolamine for 10 min.
Search related documents:
Co phrase search for related documents- C1 chip and capture vlp: 1
- C1 chip surface and capture stabilize: 1
- C1 chip surface and capture vlp: 1
- capture stabilize and limited crosslinking: 1
- flow rate and ml min: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75
- flow rate and ru level: 1
- ml min and ru level: 1
Co phrase search for related documents, hyperlinks ordered by date