Author: Cao, Rui-Yuan; Xu, Yong-fen; Zhang, Tian-Hong; Yang, Jing-Jing; Yuan, Ye; Hao, Pei; Shi, Yi; Zhong, Jin; Zhong, Wu
Title: Pediatric Drug Nitazoxanide: A Potential Choice for Control of Zika Document date: 2017_2_3
ID: sbf9qi6g_7
Snippet: Ribonucleic acid was extracted using QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer's protocol. Complementary deoxyribonucleic acid (cDNA) was synthesized using ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Ribonucleic acid was quantified using real-time polymerase chain reaction (PCR) with an Applied Biosystems 7300 real-time PCR system. Real-time PCR was performed using 2 μL of cDNA with specific primers targ.....
Document: Ribonucleic acid was extracted using QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer's protocol. Complementary deoxyribonucleic acid (cDNA) was synthesized using ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Ribonucleic acid was quantified using real-time polymerase chain reaction (PCR) with an Applied Biosystems 7300 real-time PCR system. Real-time PCR was performed using 2 μL of cDNA with specific primers targeting the genes of interest (β-actin, forward, AGTGTGACGTGGACATCCGCAAAG and reverse, ATCCACATCTGCTGGAAGGTGGAC; ZIKV, forward, CAACTACTGCAAGTGGAAGGGT and reverse, AAGTGGTCCATATGATCGGTTGA) and 5 μL of quantitative PCR SYBR Green real-time PCR Master Mix (Toyobo) in a final reaction volume of 10 μL. The cycling conditions were 45 cycles of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 30 seconds. Messenger RNA (mRNA) expression (fold induction) was quantified by calculating the 2 −ΔCT value, with β-actin mRNA as an endogenous control.
Search related documents:
Co phrase search for related documents- chain reaction and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- chain reaction and real time pcr system: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
- chain reaction and real time polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- chain reaction and real time polymerase chain reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- chain reaction and Ribonucleic acid: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- chain reaction and RT kit: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- chain reaction and specific primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- chain reaction and viral RNA Mini kit: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
- complementary deoxyribonucleic acid and real time: 1
- complementary deoxyribonucleic acid and real time polymerase: 1
- complementary deoxyribonucleic acid and real time polymerase chain reaction: 1
- complementary deoxyribonucleic acid and Ribonucleic acid: 1, 2, 3, 4, 5
- cycling condition and real time: 1
- cycling condition and real time pcr system: 1
- deoxyribonucleic acid and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9
- deoxyribonucleic acid and real time polymerase: 1, 2, 3, 4, 5, 6, 7
- deoxyribonucleic acid and real time polymerase chain reaction: 1, 2, 3, 4, 5, 6, 7
- deoxyribonucleic acid and Ribonucleic acid: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- deoxyribonucleic acid and specific primer: 1
Co phrase search for related documents, hyperlinks ordered by date