Selected article for: "cdna synthesis and Power SYBR"

Author: William Fitzsimmons; Robert J. Woods; John T. McCrone; Andrew Woodman; Jamie J. Arnold; Madhumita Yennawar; Richard Evans; Craig E. Cameron; Adam S. Lauring
Title: A speed-fidelity trade-off determines the mutation rate and virulence of an RNA virus
  • Document date: 2018_4_27
  • ID: 8p24gszj_47
    Snippet: Passage 1 virus was harvested after an additional 7 hours (8 hours since infection). The titer of 348 the passage 1 virus was used to calculate the dilution factor necessary to maintain an MOI of 349 0.1 for the subsequent 5 passages. RNA was harvested from each passage using Trizol 350 (Ambion 15596026). Random hexamers were used to prime cDNA synthesis with 1/10 of the 351 RNA. Each cDNA was analyzed by real time PCR using three different prime.....
    Document: Passage 1 virus was harvested after an additional 7 hours (8 hours since infection). The titer of 348 the passage 1 virus was used to calculate the dilution factor necessary to maintain an MOI of 349 0.1 for the subsequent 5 passages. RNA was harvested from each passage using Trizol 350 (Ambion 15596026). Random hexamers were used to prime cDNA synthesis with 1/10 of the 351 RNA. Each cDNA was analyzed by real time PCR using three different primer and/or probe sets 352 with duplicate PCR reactions for each sample/primer set. The first set, COM2F 5' 353 CATGGCAGCCCCGGAACAGG 3' and COM2R 5' TGTGATGGATCCGGGGGTAGCG 3', was 354 used to quantify total viral genomic RNA in a SYBR green reaction (Power SYBR Green PCR

    Search related documents:
    Co phrase search for related documents