Selected article for: "forward primer and primer reverse"

Author: Rohan Maddamsetti; Daniel T. Johnson; Stephanie J. Spielman; Katherine L. Petrie; Debora S. Marks; Justin R. Meyer
Title: Viral gain-of-function experiments uncover residues under diversifying selection in nature
  • Document date: 2018_1_3
  • ID: gqhlw20n_18
    Snippet: To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 . Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility. Unpurified PCR products (Forward primer: 5' CGCATCGTTCACCTCTCACT; Reverse primer: 5' CCTGCGGGCGGTTTGTCATTT) were submitted......
    Document: To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 . Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility. Unpurified PCR products (Forward primer: 5' CGCATCGTTCACCTCTCACT; Reverse primer: 5' CCTGCGGGCGGTTTGTCATTT) were submitted.

    Search related documents:
    Co phrase search for related documents
    • Forward primer and lamb coli: 1
    • Forward primer and PCR product: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
    • Forward primer and reverse primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • KEIO collection and lamb coli: 1
    • KEIO collection and reverse primer: 1
    • lamb coli and reverse primer: 1
    • PCR product and reverse primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13