Selected article for: "chain reaction and reverse forward primer"

Author: Pipirou, Zoi; Powlesland, Alex S; Steffen, Imke; Pöhlmann, Stefan; Taylor, Maureen E; Drickamer, Kurt
Title: Mouse LSECtin as a model for a human Ebola virus receptor
  • Document date: 2011_1_21
  • ID: 41i20yuy_29
    Snippet: Mutations were introduced into the expression plasmid for the CRD from human LSECtin by the overlap extension method with the polymerase chain reaction (Ho et al. 1989 ), using flanking forward primer gtcgactctagataacgaggcgc and flanking reverse primer ggtcagcagttgtgccttttctcac and mutagenic primers gggagagcccaatgacgctagggggcgcgagaactgtg and cacagttctcgcgccccctagcgtcattgggctctccc for the W259R mutation and gggagagcccaatgacgctgcggggcgcgagaactgtg a.....
    Document: Mutations were introduced into the expression plasmid for the CRD from human LSECtin by the overlap extension method with the polymerase chain reaction (Ho et al. 1989 ), using flanking forward primer gtcgactctagataacgaggcgc and flanking reverse primer ggtcagcagttgtgccttttctcac and mutagenic primers gggagagcccaatgacgctagggggcgcgagaactgtg and cacagttctcgcgccccctagcgtcattgggctctccc for the W259R mutation and gggagagcccaatgacgctgcggggcgcgagaactgtg and cacagttctcgcgccccgcagcgtcattgggctctccc for the W259A mutation. The wild-type and mutant human proteins were expressed in the folded form in the periplasm of E. coli and were purified as described previously.

    Search related documents:
    Co phrase search for related documents
    • chain reaction and extension method: 1, 2
    • chain reaction and human lsectin: 1
    • chain reaction and human protein: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20
    • chain reaction and polymerase chain reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • chain reaction and previously describe: 1, 2, 3, 4
    • expression plasmid and human protein: 1, 2, 3
    • expression plasmid and polymerase chain reaction: 1, 2, 3, 4, 5, 6, 7, 8
    • extension method and polymerase chain reaction: 1, 2
    • fold form and human protein: 1
    • human lsectin and polymerase chain reaction: 1
    • human protein and mutant human protein: 1
    • human protein and polymerase chain reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
    • human protein and previously describe: 1
    • polymerase chain reaction and previously describe: 1, 2, 3, 4