Author: Pipirou, Zoi; Powlesland, Alex S; Steffen, Imke; Pöhlmann, Stefan; Taylor, Maureen E; Drickamer, Kurt
Title: Mouse LSECtin as a model for a human Ebola virus receptor Document date: 2011_1_21
ID: 41i20yuy_29
Snippet: Mutations were introduced into the expression plasmid for the CRD from human LSECtin by the overlap extension method with the polymerase chain reaction (Ho et al. 1989 ), using flanking forward primer gtcgactctagataacgaggcgc and flanking reverse primer ggtcagcagttgtgccttttctcac and mutagenic primers gggagagcccaatgacgctagggggcgcgagaactgtg and cacagttctcgcgccccctagcgtcattgggctctccc for the W259R mutation and gggagagcccaatgacgctgcggggcgcgagaactgtg a.....
Document: Mutations were introduced into the expression plasmid for the CRD from human LSECtin by the overlap extension method with the polymerase chain reaction (Ho et al. 1989 ), using flanking forward primer gtcgactctagataacgaggcgc and flanking reverse primer ggtcagcagttgtgccttttctcac and mutagenic primers gggagagcccaatgacgctagggggcgcgagaactgtg and cacagttctcgcgccccctagcgtcattgggctctccc for the W259R mutation and gggagagcccaatgacgctgcggggcgcgagaactgtg and cacagttctcgcgccccgcagcgtcattgggctctccc for the W259A mutation. The wild-type and mutant human proteins were expressed in the folded form in the periplasm of E. coli and were purified as described previously.
Search related documents:
Co phrase search for related documents- expression plasmid and polymerase chain reaction: 1, 2, 3, 4, 5, 6, 7, 8
- expression plasmid and wild type: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
- extension method and polymerase chain reaction: 1, 2
- extension method and wild type: 1
- fold form and human protein: 1
- fold form and wild type: 1
- human lsectin and polymerase chain reaction: 1
- human protein and mutant human protein: 1
- human protein and polymerase chain reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
- human protein and previously describe: 1
- human protein and wild type: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73
- polymerase chain reaction and previously describe: 1, 2, 3, 4
- polymerase chain reaction and wild type: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43
Co phrase search for related documents, hyperlinks ordered by date