Selected article for: "bacterial vector and wild type"

Author: Banu, Nasirah; Chia, Adeline; Ho, Zi Zong; Garcia, Alfonso Tan; Paravasivam, Komathi; Grotenbreg, Gijsbert M.; Bertoletti, Antonio; Gehring, Adam J.
Title: Building and Optimizing a Virus-specific T Cell Receptor Library for Targeted Immunotherapy in Viral Infections
  • Document date: 2014_2_25
  • ID: 44w6omdp_29
    Snippet: Cloning of TCRa and TCRb chains. Total RNA was isolated from the sorted cells using RNeasy Micro kit (Qiagen) and reverse transcribed into cDNA using the 59 GeneRacer Core kit according the manufacturer's instructions (Invitrogen). PrimeSTAR MAX (Takara, Bio) was used to amplify the target gene using 59 GeneRacer primer and 39 Gene-specific primers for the TCR alpha constant domain (TCAGCTGGACCACAGCCGCAGC) and two alleles for the TCR beta constan.....
    Document: Cloning of TCRa and TCRb chains. Total RNA was isolated from the sorted cells using RNeasy Micro kit (Qiagen) and reverse transcribed into cDNA using the 59 GeneRacer Core kit according the manufacturer's instructions (Invitrogen). PrimeSTAR MAX (Takara, Bio) was used to amplify the target gene using 59 GeneRacer primer and 39 Gene-specific primers for the TCR alpha constant domain (TCAGCTGGACCACAGCCGCAGC) and two alleles for the TCR beta constant domain (Beta C1 5 TCAGAAATCCTTTCTCTTGACCATGGC; Beta C2 5 CTAGCCTCTGGAATCCTTTCTCTTG). The PCR products were ligated into TOPO-vector for bacterial transformation. Colonies were screened using the same primer pair as mentioned above to verify insert and then sequenced (AITBiotech). The sequences obtained were BLAST against the Human TCR database online (IMGT/V-Quest, http://www.imgt.org) to identify the components of the TCRs. Upon identification of the alpha and beta chains, functional confirmation was performed using the wild type sequences before synthesizing the P2A-linked single cassette, codon optimized, cystine-modified gene constructs (Genescript). The gene cassettes consisting of VaCa-P2A-VbCb and VbCb-P2A-VaCa orientations were tested for expression and functionality in primary human T cells.

    Search related documents:
    Co phrase search for related documents
    • Try single phrases listed below for: 1