Selected article for: "agarose gel and cDNA insert"

Title: Differential tumor necrosis factor alpha expression by astrocytes from experimental allergic encephalomyelitis-susceptible and -resistant rat strains
  • Document date: 1991_4_1
  • ID: 6acjgug3_17
    Snippet: monolayers of astrocytes that had been incubated with culture media, LPS, IFN-y plus LPS, and IFN-y plus IIT1# for various time intervals. RNA isolation followed the procedure of Chomczynski and Sacchi (35), as previously described (11) . Briefly, cells were scraped and washed two times in PBS, and pelleted . RNA was extracted with guanidinium isothiocyanate and phenol, and precipitated with ethanol. Polymerase Chain Reaction. PCR was performed a.....
    Document: monolayers of astrocytes that had been incubated with culture media, LPS, IFN-y plus LPS, and IFN-y plus IIT1# for various time intervals. RNA isolation followed the procedure of Chomczynski and Sacchi (35), as previously described (11) . Briefly, cells were scraped and washed two times in PBS, and pelleted . RNA was extracted with guanidinium isothiocyanate and phenol, and precipitated with ethanol. Polymerase Chain Reaction. PCR was performed as previously described (11, (36) (37) (38) . Briefly, 2 kg of total RNA isolated from astrocyte cultures was reverse transcribed by 200 U of Moloney mouse leukemia virus reverse transcriptase (Bethesda Research Laboratories, Bethesda, MD) for 10 min at room temperature, then 1 h at 42°C, using oligo(dT) as a primer, in a final volume of 20 Al . The resultingcDNA was amplified with 2 U of AmpliTaq DNA Polymerase (Perkin Elmer Cetus, Norwalk, CT) in a final volume of 100 Al, containing 10 mM Tris-HCI, 50 mM NaCl, 1.5 mM MgCI, 0.01% gelatin, 1 mM of each deoxynucleotide triphosphate, and 100 pmol each of primers I and II . Primer I (ATGAG-CACAGAAAGCATGATC) is complementary to position 144-164 of the 5' end of mouse TNF-ca cDNA (39) , and primer II (TACAGGCTTGTCACTCGAATT) is complementary to position 399-419 of the 3' end of the mouse TNF-a mRNA . Amplification was carried out in a twin block system (Ericomp Inc., San Diego, CA) for 30 cycles (one cycle = 94°C for 1 min, 55°C for 3 min, and 72°C for 3 min) . Aliquots (1-16 141) of each resulting reaction mixture were applied to a 1% agarose gel, subjected to electrophoresis, and visualized by Southern blot hybridization with a 1,300bp mouse TNT-a cDNA insert (40) . The autoradiographs were quantitated by scanning densitometry with a video densitometer (620 ; Bio-Rad Laboratories, Richmond, CA).

    Search related documents:
    Co phrase search for related documents
    • agarose gel and cdna insert: 1
    • agarose gel and culture medium: 1
    • agarose gel and final volume: 1, 2
    • agarose gel and leukemia virus: 1, 2, 3, 4
    • agarose gel and primer pmol: 1, 2
    • agarose gel and reaction mixture: 1, 2, 3, 4, 5, 6, 7, 8
    • agarose gel and reverse transcribe: 1
    • agarose gel and reverse transcriptase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
    • agarose gel and RNA isolation: 1, 2, 3, 4, 5, 6
    • agarose gel and room temperature: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
    • agarose gel and room temperature 10 min: 1
    • agarose gel and TNF mrna: 1
    • astrocyte culture and culture medium: 1
    • block system and culture medium: 1, 2
    • block system and final volume: 1