Author: Ayodeji, Mobolanle; Kulka, Michael; Jackson, Scott A; Patel, Isha; Mammel, Mark; Cebula, Thomas A; Goswami, Biswendu B
Title: A Microarray Based Approach for the Identification of Common Foodborne Viruses Document date: 2009_3_19
ID: 7s5b3lpn_13
Snippet: Labeling of PCR Products and Hybridization. PCR products were purified using a spin column procedure [Qiagen or Stratagene, (La Jolla, CA)]. One g of each purified PCR product was labeled with biotin-dUTP in a primer extension reaction using random hexamers and Klenow po- forward primer GAATGATGAGAAATGGACAGAAATG a Strains are identified by their GenBank accession number. b HAV sequence alignment is presented as the positive (sense) genomic strand.....
Document: Labeling of PCR Products and Hybridization. PCR products were purified using a spin column procedure [Qiagen or Stratagene, (La Jolla, CA)]. One g of each purified PCR product was labeled with biotin-dUTP in a primer extension reaction using random hexamers and Klenow po- forward primer GAATGATGAGAAATGGACAGAAATG a Strains are identified by their GenBank accession number. b HAV sequence alignment is presented as the positive (sense) genomic strand in 5' to 3' orientation. The primer sequence and nucleotide identity is based on the genomic sequence and nucleotide numbering of HM175 strain 18f (M59808) at nucleotide positions 3399 to 3423.
Search related documents:
Co phrase search for related documents- nucleotide identity and positive sense: 1, 2
- nucleotide identity primer sequence and primer sequence: 1
- nucleotide identity primer sequence and sequence alignment: 1
- nucleotide numbering and primer sequence: 1
- nucleotide numbering and sequence alignment: 1, 2
- nucleotide position and positive sense: 1
- nucleotide position and primer extension: 1, 2
- nucleotide position and primer sequence: 1
- nucleotide position and sequence alignment: 1, 2, 3
- PCR product and primer extension: 1
- PCR product and primer sequence: 1, 2, 3, 4, 5, 6, 7, 8
- PCR product and sequence alignment: 1
- positive sense and primer extension: 1
- positive sense and primer sequence: 1, 2
- positive sense and sequence alignment: 1, 2, 3, 4, 5, 6, 7
- primer extension and random hexamer: 1, 2
- primer extension and sequence alignment: 1
- primer sequence and random hexamer: 1
- primer sequence and sequence alignment: 1, 2, 3, 4, 5, 6, 7, 8, 9
Co phrase search for related documents, hyperlinks ordered by date