Selected article for: "genomic sequence and PCR product"

Author: Ayodeji, Mobolanle; Kulka, Michael; Jackson, Scott A; Patel, Isha; Mammel, Mark; Cebula, Thomas A; Goswami, Biswendu B
Title: A Microarray Based Approach for the Identification of Common Foodborne Viruses
  • Document date: 2009_3_19
  • ID: 7s5b3lpn_13
    Snippet: Labeling of PCR Products and Hybridization. PCR products were purified using a spin column procedure [Qiagen or Stratagene, (La Jolla, CA)]. One g of each purified PCR product was labeled with biotin-dUTP in a primer extension reaction using random hexamers and Klenow po- forward primer GAATGATGAGAAATGGACAGAAATG a Strains are identified by their GenBank accession number. b HAV sequence alignment is presented as the positive (sense) genomic strand.....
    Document: Labeling of PCR Products and Hybridization. PCR products were purified using a spin column procedure [Qiagen or Stratagene, (La Jolla, CA)]. One g of each purified PCR product was labeled with biotin-dUTP in a primer extension reaction using random hexamers and Klenow po- forward primer GAATGATGAGAAATGGACAGAAATG a Strains are identified by their GenBank accession number. b HAV sequence alignment is presented as the positive (sense) genomic strand in 5' to 3' orientation. The primer sequence and nucleotide identity is based on the genomic sequence and nucleotide numbering of HM175 strain 18f (M59808) at nucleotide positions 3399 to 3423.

    Search related documents:
    Co phrase search for related documents
    • accession number and genomic sequence: 1, 2, 3, 4
    • accession number and genomic strand: 1
    • accession number and HAV sequence alignment: 1
    • accession number and nucleotide identity: 1, 2, 3, 4, 5, 6
    • accession number and nucleotide identity primer sequence: 1
    • accession number and nucleotide numbering: 1
    • accession number and nucleotide position: 1, 2, 3
    • accession number and PCR product: 1
    • accession number and positive sense: 1, 2, 3
    • accession number and primer sequence: 1, 2, 3
    • GenBank accession number and genomic sequence: 1, 2
    • GenBank accession number and genomic strand: 1
    • GenBank accession number and HAV sequence alignment: 1
    • GenBank accession number and nucleotide identity: 1, 2, 3, 4, 5
    • GenBank accession number and nucleotide identity primer sequence: 1
    • GenBank accession number and nucleotide numbering: 1
    • GenBank accession number and nucleotide position: 1, 2, 3
    • GenBank accession number and PCR product: 1
    • GenBank accession number and positive sense: 1, 2