Selected article for: "accession number and nucleotide identity primer sequence"

Author: Ayodeji, Mobolanle; Kulka, Michael; Jackson, Scott A; Patel, Isha; Mammel, Mark; Cebula, Thomas A; Goswami, Biswendu B
Title: A Microarray Based Approach for the Identification of Common Foodborne Viruses
  • Document date: 2009_3_19
  • ID: 7s5b3lpn_15
    Snippet: reverse primer CCGAAACTGGTTTCAGCTGAGG a HAV strains are identified by their GenBank accession number. b HAV sequence alignment is presented as the reverse complement (antisense) of the genomic strand in 5' to 3' orientation. The primer sequence and nucleotide identity is based on the genomic sequence and nucleotide numbering of HM175 strain 18f (M59808) at nucleotide positions 7105 to 7084......
    Document: reverse primer CCGAAACTGGTTTCAGCTGAGG a HAV strains are identified by their GenBank accession number. b HAV sequence alignment is presented as the reverse complement (antisense) of the genomic strand in 5' to 3' orientation. The primer sequence and nucleotide identity is based on the genomic sequence and nucleotide numbering of HM175 strain 18f (M59808) at nucleotide positions 7105 to 7084.

    Search related documents:
    Co phrase search for related documents
    • accession number and genomic sequence: 1, 2, 3, 4
    • accession number and genomic strand: 1
    • accession number and HAV sequence alignment: 1
    • accession number and nucleotide identity: 1, 2, 3, 4, 5, 6
    • accession number and nucleotide identity primer sequence: 1
    • accession number and nucleotide numbering: 1
    • accession number and nucleotide position: 1, 2, 3
    • accession number and primer sequence: 1, 2, 3
    • accession number and sequence alignment: 1, 2, 3, 4, 5, 6, 7
    • GenBank accession number and genomic sequence: 1, 2
    • GenBank accession number and genomic strand: 1
    • GenBank accession number and HAV sequence alignment: 1
    • GenBank accession number and nucleotide identity: 1, 2, 3, 4, 5
    • GenBank accession number and nucleotide identity primer sequence: 1
    • GenBank accession number and nucleotide numbering: 1
    • GenBank accession number and nucleotide position: 1, 2, 3
    • GenBank accession number and primer sequence: 1, 2, 3
    • GenBank accession number and sequence alignment: 1, 2, 3, 4
    • genomic sequence and HAV sequence alignment: 1, 2