Author: Almazán, Fernando; DeDiego, Marta L.; Sola, Isabel; Zuñiga, Sonia; Nieto-Torres, Jose L.; Marquez-Jurado, Silvia; Andrés, German; Enjuanes, Luis
Title: Engineering a Replication-Competent, Propagation-Defective Middle East Respiratory Syndrome Coronavirus as a Vaccine Candidate Document date: 2013_9_10
ID: 14yfs4pa_41
Snippet: For the generation of Huh-7 cells transiently expressing E protein, cells were nucleofected with the plasmid pcDNA3-E (expressing the MERS-CoV E protein under the CMV promoter) by using a 4D Nucleofector device (Lonza) and the buffer and program recommended by the manufacturer. For the construction of plasmid pcDNA3-E, the E gene was amplified by PCR using pBAC-MERS FL as the template and the specific oligonucleotides E1-EcoRI-VS (5= GTGCTGGAATTC.....
Document: For the generation of Huh-7 cells transiently expressing E protein, cells were nucleofected with the plasmid pcDNA3-E (expressing the MERS-CoV E protein under the CMV promoter) by using a 4D Nucleofector device (Lonza) and the buffer and program recommended by the manufacturer. For the construction of plasmid pcDNA3-E, the E gene was amplified by PCR using pBAC-MERS FL as the template and the specific oligonucleotides E1-EcoRI-VS (5= GTGCTGGAATTCGCCGCCATGTTACCCTTT GTCCAAGAACGAA 3=, restriction site EcoRI is underlined) and E249-XhoI-RS (5= CGCCCAGCTCGAGTTAAACCCACTCGTCAGGTGG 3=, restriction site XhoI is underlined) and cloned into the plasmid pcDNA3 (Invitrogen) digested with EcoRI and XhoI.
Search related documents:
Co phrase search for related documents- MERS cov and restriction site: 1, 2, 3, 4, 5
- plasmid clone and restriction site: 1
Co phrase search for related documents, hyperlinks ordered by date