Selected article for: "restriction site and XhoI restriction site"

Author: Almazán, Fernando; DeDiego, Marta L.; Sola, Isabel; Zuñiga, Sonia; Nieto-Torres, Jose L.; Marquez-Jurado, Silvia; Andrés, German; Enjuanes, Luis
Title: Engineering a Replication-Competent, Propagation-Defective Middle East Respiratory Syndrome Coronavirus as a Vaccine Candidate
  • Document date: 2013_9_10
  • ID: 14yfs4pa_41
    Snippet: For the generation of Huh-7 cells transiently expressing E protein, cells were nucleofected with the plasmid pcDNA3-E (expressing the MERS-CoV E protein under the CMV promoter) by using a 4D Nucleofector device (Lonza) and the buffer and program recommended by the manufacturer. For the construction of plasmid pcDNA3-E, the E gene was amplified by PCR using pBAC-MERS FL as the template and the specific oligonucleotides E1-EcoRI-VS (5= GTGCTGGAATTC.....
    Document: For the generation of Huh-7 cells transiently expressing E protein, cells were nucleofected with the plasmid pcDNA3-E (expressing the MERS-CoV E protein under the CMV promoter) by using a 4D Nucleofector device (Lonza) and the buffer and program recommended by the manufacturer. For the construction of plasmid pcDNA3-E, the E gene was amplified by PCR using pBAC-MERS FL as the template and the specific oligonucleotides E1-EcoRI-VS (5= GTGCTGGAATTCGCCGCCATGTTACCCTTT GTCCAAGAACGAA 3=, restriction site EcoRI is underlined) and E249-XhoI-RS (5= CGCCCAGCTCGAGTTAAACCCACTCGTCAGGTGG 3=, restriction site XhoI is underlined) and cloned into the plasmid pcDNA3 (Invitrogen) digested with EcoRI and XhoI.

    Search related documents:
    Co phrase search for related documents
    • CMV promoter and plasmid clone: 1
    • CMV promoter and plasmid construction: 1, 2
    • CMV promoter and restriction site: 1, 2, 3
    • MERS cov and plasmid clone: 1, 2
    • MERS cov and restriction site: 1, 2, 3, 4, 5