Author: Almazán, Fernando; DeDiego, Marta L.; Sola, Isabel; Zuñiga, Sonia; Nieto-Torres, Jose L.; Marquez-Jurado, Silvia; Andrés, German; Enjuanes, Luis
Title: Engineering a Replication-Competent, Propagation-Defective Middle East Respiratory Syndrome Coronavirus as a Vaccine Candidate Document date: 2013_9_10
ID: 14yfs4pa_42
Snippet: Analysis of viral RNA synthesis by RT-qPCR. Total intracellular RNA was extracted from transfected or infected cells with the RNeasy miniprep kit (Qiagen) according to the manufacturer's specifications. In the case of transfected cells, the residual DNA was removed from samples by treating 7 g of each RNA with 20 U of DNase I (Roche) in 100 l for 30 min at 37°C, and DNA-free RNAs were repurified using the RNeasy miniprep kit (Qiagen). Viral RNA .....
Document: Analysis of viral RNA synthesis by RT-qPCR. Total intracellular RNA was extracted from transfected or infected cells with the RNeasy miniprep kit (Qiagen) according to the manufacturer's specifications. In the case of transfected cells, the residual DNA was removed from samples by treating 7 g of each RNA with 20 U of DNase I (Roche) in 100 l for 30 min at 37°C, and DNA-free RNAs were repurified using the RNeasy miniprep kit (Qiagen). Viral RNA synthesis was quantified by RT-qPCR. Total cDNA was synthesized with random hexamers from 100 ng of total RNA using a high-capacity cDNA reverse transcription kit (Invitrogen). Using this cDNA, the viral RNA synthesis was analyzed using two custom TaqMan assays specific for MERS-CoV gRNA (forward primer 5= GCACATCTGT GGTTCTCCTCTCT 3=, reverse primer 5= AAGCCCAGGCCCTACTAT TAGC 3=, and MGB probe 5= TGCTCCAACAGTTACAC 3=) and sgmRNA N (forward primer 5= CTTCCCCTCGTTCTCTTGCA 3=, reverse primer 5= TCATTGTTATCGGCAAAGGAAA 3=, and MGB probe 5= CTTTGATTTTAACGAATCTC 3=). Data were acquired with an Applied Biosystems 7500 real-time PCR system and analyzed with ABI PRISM 7500 software, version 2.0.5. The relative quantifications were performed using the cycle threshold (2 Ϫ⌬⌬CT ) method (63) . To normalize for differences in RNA sampling, the expression of eukaryotic 18S rRNA was analyzed using a specific TaqMan gene expression assay (Hs99999901_s1; Applied Biosystems).
Search related documents:
Co phrase search for related documents- pcr system and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79
- pcr system and real time pcr system: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78
- pcr system and relative quantification: 1, 2, 3
- pcr system and reverse transcription kit: 1, 2, 3, 4, 5, 6, 7, 8
- pcr system and RNA synthesis: 1, 2, 3, 4, 5
- pcr system and TaqMan assay: 1, 2, 3
- pcr system and total cdna: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
- pcr system and transcription kit: 1, 2, 3, 4, 5, 6, 7, 8
- pcr system and viral RNA synthesis: 1
- random hexamer and real time: 1, 2, 3, 4
- random hexamer and RNA synthesis: 1, 2
- TaqMan assay and transcription kit: 1
- TaqMan gene expression assay and transcription kit: 1
- total cdna and transcription kit: 1, 2, 3, 4, 5, 6, 7
- transfected cell and viral RNA synthesis: 1
Co phrase search for related documents, hyperlinks ordered by date