Selected article for: "real time pcr and threshold cycle"

Author: Almazán, Fernando; DeDiego, Marta L.; Sola, Isabel; Zuñiga, Sonia; Nieto-Torres, Jose L.; Marquez-Jurado, Silvia; Andrés, German; Enjuanes, Luis
Title: Engineering a Replication-Competent, Propagation-Defective Middle East Respiratory Syndrome Coronavirus as a Vaccine Candidate
  • Document date: 2013_9_10
  • ID: 14yfs4pa_42
    Snippet: Analysis of viral RNA synthesis by RT-qPCR. Total intracellular RNA was extracted from transfected or infected cells with the RNeasy miniprep kit (Qiagen) according to the manufacturer's specifications. In the case of transfected cells, the residual DNA was removed from samples by treating 7 g of each RNA with 20 U of DNase I (Roche) in 100 l for 30 min at 37°C, and DNA-free RNAs were repurified using the RNeasy miniprep kit (Qiagen). Viral RNA .....
    Document: Analysis of viral RNA synthesis by RT-qPCR. Total intracellular RNA was extracted from transfected or infected cells with the RNeasy miniprep kit (Qiagen) according to the manufacturer's specifications. In the case of transfected cells, the residual DNA was removed from samples by treating 7 g of each RNA with 20 U of DNase I (Roche) in 100 l for 30 min at 37°C, and DNA-free RNAs were repurified using the RNeasy miniprep kit (Qiagen). Viral RNA synthesis was quantified by RT-qPCR. Total cDNA was synthesized with random hexamers from 100 ng of total RNA using a high-capacity cDNA reverse transcription kit (Invitrogen). Using this cDNA, the viral RNA synthesis was analyzed using two custom TaqMan assays specific for MERS-CoV gRNA (forward primer 5= GCACATCTGT GGTTCTCCTCTCT 3=, reverse primer 5= AAGCCCAGGCCCTACTAT TAGC 3=, and MGB probe 5= TGCTCCAACAGTTACAC 3=) and sgmRNA N (forward primer 5= CTTCCCCTCGTTCTCTTGCA 3=, reverse primer 5= TCATTGTTATCGGCAAAGGAAA 3=, and MGB probe 5= CTTTGATTTTAACGAATCTC 3=). Data were acquired with an Applied Biosystems 7500 real-time PCR system and analyzed with ABI PRISM 7500 software, version 2.0.5. The relative quantifications were performed using the cycle threshold (2 Ϫ⌬⌬CT ) method (63) . To normalize for differences in RNA sampling, the expression of eukaryotic 18S rRNA was analyzed using a specific TaqMan gene expression assay (Hs99999901_s1; Applied Biosystems).

    Search related documents:
    Co phrase search for related documents
    • cycle threshold and high capacity: 1, 2, 3, 4, 5
    • cycle threshold and high capacity cdna: 1
    • cycle threshold and pcr system: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15
    • cycle threshold and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76
    • cycle threshold and real time pcr system: 1, 2, 3, 4, 5, 6, 7, 8
    • cycle threshold and relative quantification: 1
    • cycle threshold and reverse transcription kit: 1, 2
    • cycle threshold and RNA sampling: 1, 2, 3, 4, 5
    • cycle threshold and RNA synthesis: 1
    • cycle threshold and TaqMan assay: 1, 2, 3
    • cycle threshold and total cdna: 1, 2, 3, 4, 5, 6
    • cycle threshold and transcription kit: 1, 2
    • cycle threshold and transfected cell: 1
    • dna free rna and infected transfected cell: 1
    • dna free rna and pcr system: 1, 2
    • dna free rna and real time: 1, 2, 3
    • dna free rna and RNA sampling: 1
    • dna free rna and transfected cell: 1
    • gene expression and high capacity: 1, 2, 3, 4, 5, 6, 7, 8