Selected article for: "GenBank database and PCR reaction"

Author: ALFRED, Niyokwishimira; LIU, Huan; LI, Mu Lan; HONG, Shao Feng; TANG, Hai Bo; WEI, Zu Zhang; CHEN, Ying; LI, Fa Kai; ZHONG, Yi Zhi; HUANG, Wei Jian
Title: Molecular epidemiology and phylogenetic analysis of diverse bovine astroviruses associated with diarrhea in cattle and water buffalo calves in China
  • Document date: 2015_2_13
  • ID: 029hqc82_7
    Snippet: Detection of bovine astrovirus and genome cloning and sequencing: Bovine astrovirus was detected by reverse transcriptase polymerase chain reaction (RT-PCR) analysis using the degenerate primer pair (forward) DPF 5′-GAYTG-GACBCGHTWTGATGG-3′ and (reverse) DPR 5′-KYT-TRACCCACATNCCAA-3′ to target a 418-bp fragment of the RdRp region common to astroviruses, as described previously [21] with some modifications. Some of the RT-PCR-positive samp.....
    Document: Detection of bovine astrovirus and genome cloning and sequencing: Bovine astrovirus was detected by reverse transcriptase polymerase chain reaction (RT-PCR) analysis using the degenerate primer pair (forward) DPF 5′-GAYTG-GACBCGHTWTGATGG-3′ and (reverse) DPR 5′-KYT-TRACCCACATNCCAA-3′ to target a 418-bp fragment of the RdRp region common to astroviruses, as described previously [21] with some modifications. Some of the RT-PCR-positive samples were sequenced and primarily analyzed by comparison of nucleotide sequences using the online Basic Local Alignment Search Tool (http://blast.ncbi. nlm.nih.gov/Blast.cgi) to confirm the detection of astrovi-ruses. Subsequently, we amplified the 3′-end of ORF2 and the ORF1b/ORF2 regions, which have been confirmed by subgenomic RNA analysis for characterization of astroviruses. Since the direct amplification with gene specific primers (GSPs) failed, the Rapid Amplification of cDNA Ends (RACE) method was implemented to amplify the 3′-end of the ORF1b/ORF2 region. The 3′-end RACE amplification was performed as described previously [16] with the following modifications to the primer pair: QT 5′-CCAGTGAGC AGAGTGACGAGGACTCGAGCTCAAGCT (T) 16 -3′ and QO 5′-CCAGTGAGCAGAGTGACG-3′. The RACE products were reused as templates in a nested PCR performed to amplify desired sequences using GSPs designed in this study based on the B76-2/HK sequence available in the GenBank database (http://www.ncbi.nlm.nih.gov/genbank/) under the accession number HQ916317.1.The GSPs were designed using OLIGO 7 software (Molecular Biology Insights, Inc., Colorado Springs, CO, U.S.A.). The nucleotide sequences of the primer pairs used to amplify the partial 3′-end of ORF2 were as follows: (forward, B1205F and B1350F) 5′-CAG-GTCACCCCAGGCAACAC-3′ and 5′-ATCATACAGGC-GGGCACGAGT-3′, respectively, and (reverse, B1205R) 5′-CCCTTCACCTATGCTAATCAAATC-3′ (expected products length, 1,200 and 1,426 bp, respectively). The two primer pairs used to amplify the ORF1b/ORF2 region were as follows: (1) The PCR cycling conditions consisted of 95°C for 5 min followed by 35 cycles of 94°C for 1 min, 52°C for 1 min, 72°C for 1 min and a final extension step at 72°C for 10 min in an automated thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA, U.S.A.). 3′-RACE PCR and amplification of the ORF1b/ORF2 region were performed under the same conditions as for the PCR analysis described above with cycling set at 58°C as the annealing temperature for 3′RACE and 56°C as the annealing temperature for amplification of the ORF1b/ORF2 region and an elongation step at 72°C for 1 min for each 1 kb.

    Search related documents:
    Co phrase search for related documents
    • accession number and chain reaction: 1, 2, 3, 4, 5
    • accession number and GenBank database: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
    • accession number and nucleotide sequence: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
    • accession number and nucleotide sequence comparison: 1, 2, 3
    • accession number and PCR analysis: 1, 2, 3
    • accession number and previously describe: 1
    • accession number and primer pair: 1
    • accession number and specific primer: 1
    • annealing temperature and chain reaction: 1, 2, 3
    • annealing temperature and extension step: 1
    • annealing temperature and GenBank database: 1, 2
    • annealing temperature and nucleotide sequence: 1, 2
    • annealing temperature and primer pair: 1, 2, 3
    • annealing temperature and specific primer: 1, 2, 3