Selected article for: "MERS cov and PCR product"

Author: Almazán, Fernando; DeDiego, Marta L.; Sola, Isabel; Zuñiga, Sonia; Nieto-Torres, Jose L.; Marquez-Jurado, Silvia; Andrés, German; Enjuanes, Luis
Title: Engineering a Replication-Competent, Propagation-Defective Middle East Respiratory Syndrome Coronavirus as a Vaccine Candidate
  • Document date: 2013_9_10
  • ID: 14yfs4pa_36
    Snippet: The deletions of genes 4a, 4b, and 5 were introduced by PCR-directed mutagenesis, using as a template the plasmid pBAC-MERS-3= (a BAC plasmid containing the MERS-3= fragment spanning nucleotides 25,836 to 30,107 of the MERS-CoV genome). For deletion of genes 4a and 4b, overlapping PCR fragments were amplified using oligonucleotides del4ab-VS (5= GAACTCTATGGATTACGGTTGTCTCCATACGGTC 3=) and del4ab-RS (5= GACCGTATGGAGACAACCGTAATCCATAGA GTT 3=). The f.....
    Document: The deletions of genes 4a, 4b, and 5 were introduced by PCR-directed mutagenesis, using as a template the plasmid pBAC-MERS-3= (a BAC plasmid containing the MERS-3= fragment spanning nucleotides 25,836 to 30,107 of the MERS-CoV genome). For deletion of genes 4a and 4b, overlapping PCR fragments were amplified using oligonucleotides del4ab-VS (5= GAACTCTATGGATTACGGTTGTCTCCATACGGTC 3=) and del4ab-RS (5= GACCGTATGGAGACAACCGTAATCCATAGA GTT 3=). The final PCR product was amplified with outer oligonucleotides T7 and SA27201RS (5= CAAACAGTGGAATGTAGG 3=), digested with PacI and NheI, and cloned into the same restriction sites of pBAC-MERS-3=, leading to pBAC-MERS-3=-⌬4ab that contains a deletion spanning nucleotides 25,862 to 26,751 of the MERS-CoV genome. For gene 5 deletion, a PCR fragment lacking gene 5 (nucleotides 26,835 to 27,513) was amplified using oligonucleotides SA25834VS (5= GTTAATTAACGA ACTCTATGGATTACG 3=, where the restriction site PacI is underlined) and del5-SanDI-RS (5= CACGGGACCCATAGTAGCGCAGAGCTGCT GTTAAAATCCTGGATG 3=, where the restriction site SanDI is underlined), digested with PacI and SanDI, and cloned in the same sites of pBAC-MERS-3=, leading to pBAC-MERS-3=-⌬5. To generate plasmids pBAC-MERS-⌬4ab and pBAC-MERS-⌬5, the PacI-RsrII digestion products from plasmids pBAC-MERS-3=-⌬4ab and pBAC-MERS-3=-⌬5 were cloned in the same sites of pBAC-MERS FL (Fig. 3A) . All cloning steps were checked by sequencing of the PCR fragments and cloning junctions.

    Search related documents:
    Co phrase search for related documents
    • clone step and MERS cov: 1, 2
    • clone step and pBAC site: 1
    • clone step and restriction site: 1, 2
    • digestion product and gene deletion: 1
    • digestion product and MERS cov: 1
    • digestion product and MERS CoV genome: 1
    • digestion product and PacI restriction site: 1
    • digestion product and PCR product: 1
    • digestion product and restriction site: 1, 2