Author: Ma, Yuanmei; Zhang, Yu; Liang, Xueya; Lou, Fangfei; Oglesbee, Michael; Krakowka, Steven; Li, Jianrong
Title: Origin, Evolution, and Virulence of Porcine Deltacoronaviruses in the United States Document date: 2015_3_10
ID: 6o7j5k9n_40
Snippet: Quantification of viral RNAs by RT-qPCR. Feces and intestinal contents were diluted 1:5 in DMEM and centrifuged at 5,000 ϫ g for 10 min at 4°C, and the supernatant was collected for viral RNA extraction. The total RNA was extracted by using an RNeasy minikit (Qiagen, Valencia, CA). Reverse transcription (RT) was conducted using a primer (5= TTTT GCTCCATCCCCCCTATAAGC 3=) targeting the 3=-end UTR of PdCV and the Superscript III transcriptase kit .....
Document: Quantification of viral RNAs by RT-qPCR. Feces and intestinal contents were diluted 1:5 in DMEM and centrifuged at 5,000 ϫ g for 10 min at 4°C, and the supernatant was collected for viral RNA extraction. The total RNA was extracted by using an RNeasy minikit (Qiagen, Valencia, CA). Reverse transcription (RT) was conducted using a primer (5= TTTT GCTCCATCCCCCCTATAAGC 3=) targeting the 3=-end UTR of PdCV and the Superscript III transcriptase kit (Invitrogen, Carlsbad, CA). The RT products were then used to perform real-time PCR using primers and probes specifically targeting the N gene of PdCV (forward, 5= CGCTTAA CTCCGCCATCAA 3=; reverse, 5= TCTGGTGTAACGCAGCCAGTA 3=; probe, 5= 6FAM-CCCGTTGAAAACC-MGB 3= [6FAM is 6-carboxyfluorescein] [Applied Biosystems, Foster City, CA]) in a StepOne realtime PCR system (Applied Biosystems). A standard plasmid for PdCV was constructed by inserting the sequence of the entire PdCV N gene into the pGEM-T Easy vector (Promega, Madison, WI). Amplification cycles used were 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. The threshold for detection of fluorescence above the background was set within the exponential phase of the amplification curves. For each assay, 10-fold dilutions of standard plasmid were generated, and negativecontrol samples and double-distilled water (ddH 2 O) were included in each assay.
Search related documents:
Co phrase search for related documents- RNA extraction and RT product: 1, 2, 3, 4
- RNA extraction and RT qPCR viral rna quantification: 1, 2
- RNA extraction and RT reverse transcription: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73
- RNA extraction and standard plasmid: 1, 2
- RNA extraction and transcriptase kit: 1
- RNeasy minikit and Valencia Qiagen RNeasy minikit: 1
- RT product and RT reverse transcription: 1, 2, 3
- RT product and viral rna: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
- RT product and viral RNA extraction: 1
- RT qPCR viral rna quantification and viral rna: 1, 2, 3, 4, 5
- RT qPCR viral rna quantification and viral RNA extraction: 1, 2
- RT qPCR viral rna quantification and viral rna quantification: 1, 2, 3, 4, 5
- RT reverse transcription and standard plasmid: 1, 2, 3, 4
- RT reverse transcription and transcriptase kit: 1, 2
- RT reverse transcription and viral rna: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75
- RT reverse transcription and viral RNA extraction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22
- RT reverse transcription and viral rna quantification: 1, 2, 3, 4
- standard plasmid and viral rna: 1, 2, 3, 4, 5, 6, 7
- standard plasmid and viral RNA extraction: 1, 2
Co phrase search for related documents, hyperlinks ordered by date