Author: Ma, Yuanmei; Zhang, Yu; Liang, Xueya; Lou, Fangfei; Oglesbee, Michael; Krakowka, Steven; Li, Jianrong
Title: Origin, Evolution, and Virulence of Porcine Deltacoronaviruses in the United States Document date: 2015_3_10
ID: 6o7j5k9n_40
Snippet: Quantification of viral RNAs by RT-qPCR. Feces and intestinal contents were diluted 1:5 in DMEM and centrifuged at 5,000 ϫ g for 10 min at 4°C, and the supernatant was collected for viral RNA extraction. The total RNA was extracted by using an RNeasy minikit (Qiagen, Valencia, CA). Reverse transcription (RT) was conducted using a primer (5= TTTT GCTCCATCCCCCCTATAAGC 3=) targeting the 3=-end UTR of PdCV and the Superscript III transcriptase kit .....
Document: Quantification of viral RNAs by RT-qPCR. Feces and intestinal contents were diluted 1:5 in DMEM and centrifuged at 5,000 ϫ g for 10 min at 4°C, and the supernatant was collected for viral RNA extraction. The total RNA was extracted by using an RNeasy minikit (Qiagen, Valencia, CA). Reverse transcription (RT) was conducted using a primer (5= TTTT GCTCCATCCCCCCTATAAGC 3=) targeting the 3=-end UTR of PdCV and the Superscript III transcriptase kit (Invitrogen, Carlsbad, CA). The RT products were then used to perform real-time PCR using primers and probes specifically targeting the N gene of PdCV (forward, 5= CGCTTAA CTCCGCCATCAA 3=; reverse, 5= TCTGGTGTAACGCAGCCAGTA 3=; probe, 5= 6FAM-CCCGTTGAAAACC-MGB 3= [6FAM is 6-carboxyfluorescein] [Applied Biosystems, Foster City, CA]) in a StepOne realtime PCR system (Applied Biosystems). A standard plasmid for PdCV was constructed by inserting the sequence of the entire PdCV N gene into the pGEM-T Easy vector (Promega, Madison, WI). Amplification cycles used were 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. The threshold for detection of fluorescence above the background was set within the exponential phase of the amplification curves. For each assay, 10-fold dilutions of standard plasmid were generated, and negativecontrol samples and double-distilled water (ddH 2 O) were included in each assay.
Search related documents:
Co phrase search for related documents- amplification curve and pcr system: 1, 2, 3, 4, 5
- amplification curve and probe primer: 1, 2, 3, 4
- amplification curve and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
- amplification curve and reverse transcription: 1, 2, 3, 4
- amplification curve and RNA extraction: 1, 2
- amplification curve and RT reverse transcription: 1, 2, 3
- amplification curve and viral rna: 1, 2, 3
- amplification curve and viral RNA extraction: 1, 2
- amplification cycle and pcr system: 1, 2
- amplification cycle and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
- amplification cycle and real time PCR perform: 1, 2
- amplification cycle and reverse transcription: 1, 2, 3
- amplification cycle and RNA extraction: 1, 2, 3
- amplification cycle and RT product: 1
- amplification cycle and RT reverse transcription: 1, 2
- amplification cycle and viral rna: 1, 2, 3, 4, 5
- amplification cycle and viral RNA extraction: 1
Co phrase search for related documents, hyperlinks ordered by date