Selected article for: "exponential phase and real time"

Author: Ma, Yuanmei; Zhang, Yu; Liang, Xueya; Lou, Fangfei; Oglesbee, Michael; Krakowka, Steven; Li, Jianrong
Title: Origin, Evolution, and Virulence of Porcine Deltacoronaviruses in the United States
  • Document date: 2015_3_10
  • ID: 6o7j5k9n_40
    Snippet: Quantification of viral RNAs by RT-qPCR. Feces and intestinal contents were diluted 1:5 in DMEM and centrifuged at 5,000 ϫ g for 10 min at 4°C, and the supernatant was collected for viral RNA extraction. The total RNA was extracted by using an RNeasy minikit (Qiagen, Valencia, CA). Reverse transcription (RT) was conducted using a primer (5= TTTT GCTCCATCCCCCCTATAAGC 3=) targeting the 3=-end UTR of PdCV and the Superscript III transcriptase kit .....
    Document: Quantification of viral RNAs by RT-qPCR. Feces and intestinal contents were diluted 1:5 in DMEM and centrifuged at 5,000 ϫ g for 10 min at 4°C, and the supernatant was collected for viral RNA extraction. The total RNA was extracted by using an RNeasy minikit (Qiagen, Valencia, CA). Reverse transcription (RT) was conducted using a primer (5= TTTT GCTCCATCCCCCCTATAAGC 3=) targeting the 3=-end UTR of PdCV and the Superscript III transcriptase kit (Invitrogen, Carlsbad, CA). The RT products were then used to perform real-time PCR using primers and probes specifically targeting the N gene of PdCV (forward, 5= CGCTTAA CTCCGCCATCAA 3=; reverse, 5= TCTGGTGTAACGCAGCCAGTA 3=; probe, 5= 6FAM-CCCGTTGAAAACC-MGB 3= [6FAM is 6-carboxyfluorescein] [Applied Biosystems, Foster City, CA]) in a StepOne realtime PCR system (Applied Biosystems). A standard plasmid for PdCV was constructed by inserting the sequence of the entire PdCV N gene into the pGEM-T Easy vector (Promega, Madison, WI). Amplification cycles used were 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. The threshold for detection of fluorescence above the background was set within the exponential phase of the amplification curves. For each assay, 10-fold dilutions of standard plasmid were generated, and negativecontrol samples and double-distilled water (ddH 2 O) were included in each assay.

    Search related documents:
    Co phrase search for related documents
    • amplification curve and pcr system: 1, 2, 3, 4, 5
    • amplification curve and probe primer: 1, 2, 3, 4
    • amplification curve and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
    • amplification curve and reverse transcription: 1, 2, 3, 4
    • amplification curve and RNA extraction: 1, 2
    • amplification curve and RT reverse transcription: 1, 2, 3
    • amplification curve and viral rna: 1, 2, 3
    • amplification curve and viral RNA extraction: 1, 2
    • amplification cycle and fluorescence detection: 1
    • amplification cycle and pcr system: 1, 2
    • amplification cycle and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
    • amplification cycle and real time PCR perform: 1, 2
    • amplification cycle and reverse transcription: 1, 2, 3
    • amplification cycle and RNA extraction: 1, 2, 3
    • amplification cycle and RT product: 1
    • amplification cycle and RT reverse transcription: 1, 2