Selected article for: "correct orientation and psvx polylinker"

Title: The first membrane spanning region of the lamin B receptor is sufficient for sorting to the inner nuclear membrane
  • Document date: 1993_2_1
  • ID: 3qi2llmr_6
    Snippet: p58ATM2-8, Including Insertion of the HA Tag. p58cDNA was digested with BsmAI, blunt ended with DNA polymerase, Klenow fragment, and digested with EcoRI. The resulting fragment (containing the 5' untranslated region and codons I through 246) was cloned into the EcoRI and SmaI sites of the pSVX polylinker in the correct orientation with respect to the SV-40 early promoter. Subsequently, the HA tag was inserted in frame into this construct. A fragm.....
    Document: p58ATM2-8, Including Insertion of the HA Tag. p58cDNA was digested with BsmAI, blunt ended with DNA polymerase, Klenow fragment, and digested with EcoRI. The resulting fragment (containing the 5' untranslated region and codons I through 246) was cloned into the EcoRI and SmaI sites of the pSVX polylinker in the correct orientation with respect to the SV-40 early promoter. Subsequently, the HA tag was inserted in frame into this construct. A fragment containing the nine codons of the HA epitope tag (Wilson et al., 1984) and flanking SpeI sites was generated by two complementary oligonucleotides 5"CTACTTACCCATACGATGTTCCAGATT-ACGCTC-3' and 5-CTAEK2AGCGTAATCTGGAACATCGTA'IUC~TAA-3' (HA codons are underlined) and inserted into the unique SpeI site beginning at codon 28 of p58. Insertion of the oligonncleotide regenerated the site 5' but not 3' to the tag and thus, insertion of a single HA tag in the correct orientation was confirmed by restriction enzyme digest analysis. The resulting construct, p58ATM2-8, contained p58 codons 1 through 29, nine codons of the HA tag, a serine codon (ACT) introduction by the cloning, and p58 codons 30 through 246. The organization of the HA tag was identical in all constructs, p58ATM2-8 contains p58 amino acids 1-246.

    Search related documents:
    Co phrase search for related documents
    • amino acid and complementary oligonucleotide: 1
    • amino acid and correct orientation: 1, 2, 3
    • amino acid and dna polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18
    • amino acid and epitope tag: 1, 2, 3, 4
    • amino acid and frame insert: 1, 2
    • amino acid and HA codon: 1
    • amino acid and HA epitope tag: 1
    • amino acid and HA tag: 1, 2, 3, 4
    • amino acid and Klenow fragment: 1