Complete viral RNA genome sequencing of ultra-low copy samples by sequence-independent amplification

Malboeuf, Christine M.; Yang, Xiao; Charlebois, Patrick; Qu, James; Berlin, Aaron M.; Casali, Monica; Pesko, Kendra N.; Boutwell, Christian L.; DeVincenzo, John P.; Ebel, Gregory D.; Allen, Todd M.; Zody, Michael C.; Henn, Matthew R.; Levin, Joshua Z.

For HIV clinical samples, 1.5 ml of plasma was thawed and centrifuged at 1500g for 10 min at 4 C to remove cellular debris. For HIV and WNV clone samples, 140 ml of cell culture supernatant was used for extraction. All samples were brought up to volume with 1Â PBS and centrifuged at 120 000g for 1.5 hours at 4 C after which the pellet was re-suspended in 140 ml of 1Â PBS and used as input for viral RNA extraction. For RSV clinical samples, 140 ml of nasal aspirate was used for extraction (without the 120 000g centrifugation step). Viral RNA was isolated using QIAamp Viral RNA Mini kit (Qiagen) per manufacturer's protocol with the exception that 5 mg of linear polyacrylamide (Life Technologies) was used as the carrier instead of the carrier RNA provided with the kit. Viral RNA was eluted with 60 ml of AVE buffer, aliquoted and stored at À80 C. All viral samples were treated with Turbo DNase (Life Technologies) using the manufacturer's rigorous treatment to ensure removal of DNA. For each HIV sample, quantitative RT-PCR (qRT-PCR) was used to measure the number of copies of HIV. These experiments were performed with the ABI 7900HT (Life Technologies) using HIV-1 gag SK145 (AGTGGGGGGACATCAAGCAGCCATGCA AAT) and SK431 (TGCTATGTCACTTCCCCTTGGT TCTCT) primers (31) at 300 nM final concentration and the SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Life Technologies) per manufacturer's protocol. The quantification standards consisted of linear HIV-1 pNL4-3 plasmid. Similarly to HIV, the number of WNV copies in each sample was also quantified by qRT-PCR performed on the ABI 7900HT using forward primer (TCAGCGATCTCTCCACCAAAG), reverse primer (GGGTCAGCACGTTTGTCATTG), probe (FAM-TGCCCGACCATGGGAGAAGCTC-TAMRA) and the SuperScript III Platinum One-Step qRT-PCR Kit (Life Technologies) per manufacturer's protocol and previously described methods (32) . In addition, the number of RSV copies in each sample was also quantified by qRT-PCR performed on the ABI 7900HT using forward primer (CATCCAGCAAATAC ACCATCCA), reverse primer (TTCTGCACATCATAA TTAGGAGTATCAA), probe (FAM-CGGAGCACAG GAGAT-TAMRA) and the SuperScript III Platinum One-Step qRT-PCR Kit (Life Technologies) per manufacturer's protocol and previously described methods (33) . Host 18S ribosomal RNA (rRNA) was quantified for all samples using the ABI 7900HT and the TaqMan ribosomal RNA primer and probes following the manufacturer's protocol (Life Technologies).