Selected article for: "inserted sequence and template dna"

Author: Usui, Kimihito; Ichihashi, Norikazu; Yomo, Tetsuya
Title: A design principle for a single-stranded RNA genome that replicates with less double-strand formation
  • Document date: 2015_9_18
  • ID: znhvdtg8_7
    Snippet: Plasmids encoding the ␣-domain were constructed by ligating two PCR fragments prepared using pUC-MDV-LR (27) as a template and primers (CGTCACGGTC-GAACTCCC and AGTCACGGGCTAGCGCTTTC) or using pUC19 as a template and primers (AGTTC-GACCGTGACGAATTGTGAGCGGATAACAATTTC and GCGCTAGCCCGTGACTCTATGC). The latter fragment contains the ␣-domain gene that originated from the pUC19 vector. The ligation was performed with an InFusion kit (Clontech). The Sma.....
    Document: Plasmids encoding the ␣-domain were constructed by ligating two PCR fragments prepared using pUC-MDV-LR (27) as a template and primers (CGTCACGGTC-GAACTCCC and AGTCACGGGCTAGCGCTTTC) or using pUC19 as a template and primers (AGTTC-GACCGTGACGAATTGTGAGCGGATAACAATTTC and GCGCTAGCCCGTGACTCTATGC). The latter fragment contains the ␣-domain gene that originated from the pUC19 vector. The ligation was performed with an InFusion kit (Clontech). The SmaI site inside of the ␣-domain was removed by inserting a point mutation (CCCGGG to CCCGTG). The mutant m1 sequence was synthesized chemically (Gene Design, Inc., Japan) and inserted into pUC-MDV-LR (27) as described above using the synthesized DNA as a template instead of pUC19 to obtain pUC-mdv-␣ mutA. The other mutants (m2- 14) were constructed by successive PCR and self-ligation processes using primers to delete or change the target sequences and pUC-mdv-␣ mutA as a template. The entire sequences of these RNAs are provided in the Supplemental text. These RNAs were prepared by in vitro transcription as described above.

    Search related documents:
    Co phrase search for related documents
    • Try single phrases listed below for: 1