Construction and next-generation sequencing analysis of a large phage-displayed V(NAR) single-domain antibody library from six naïve nurse sharks

Feng, Mingqian; Bian, Hejiao; Wu, Xiaolin; Fu, Tianyun; Fu, Ying; Hong, Jessica; Fleming, Bryan D; Flajnik, Martin F; Ho, Mitchell

Six naïve nurse sharks (three males and three females, ranging from 2.5 to 6 ft long) were bled for 10 ml of blood in phosphate buffered saline (PBS)/1000 IU/ml heparin. The buffy coat was collected, spun, and resuspended in 3.5 ml of Trizol for RNA preparation. Total RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific, Grand Island, NY) according to the manufacturer's instruction. Five micrograms of total RNA were reverse-transcribed into cDNA in a total of 20 μl volume using the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific) according to the manufacturer's instruction. One forward primer and two reverse primers were synthesized to PCR amplify the V NAR sequence from the cDNA product. Forward primer IgNAR-F: GCTC-GAGTGACCAAACACCG, reverse primer IgNAR-R1: GGTGGCCGGCCTGGCCACTATTCACAGTCACGG CAGTGCCAT, reverse primer IgNAR-R2: GGTGGC-CGGCCTGGCCACTATTCACAGTCACGACAGTGC-CACC. Primer pairs of IgNAR-F/IgNAR-R1, IgNAR-F/IgNAR-R1 were used to amplify the V NAR fragment in a 50 μl of PCR volume that contains 1 μl of cDNA product. The PCR cycling parameters were the following: initial denaturation at 94 • C for 3 min, 40 cycles of denaturation at 98 • C for 10 s, annealing at 60 • C for 15 s, and elongation at 72 • C for 45 s using PrimeStar (CloneTech). In the meantime, the linear vector backbone fragment was prepared by PCR using forward primer IgNARCom3x-F: AGTGGCCAGGCCGGCCACC, and reverse primer IgNARCom3x-R: GGCCGCCTGGGCCACGGTA. Five nanograms of the plasmid pComb3X was used as the template in a total of 50 μl of PCR reaction volume. The primers to amplify the vector backbone were forward IgNARCom3x-F: AGTGGCCAGGCCGGCCACC and reverse IgNARCom3x-R: GGCCGCCTGGGCCACG-GTA. The PCR cycling parameters were the following: initial denaturation at 94 • C for 3 min, then 25 cycles of denaturation at 98 • C for 10 s, annealing at 60 • C for 15 s, and elongation at 72 • C for 3 min using PrimeStar (Takara, Shiga, Japan). To assemble the V NAR and the amplified vector backbone, 100 ng of vector backbone was mixed with 30 ng of V NAR PCR products in a 50 μl of PCR reaction volume, the overlapping extension PCR was primed by primers of IgNAR-F/IgNARCom3x-R using PrimeStar. Twenty micrograms of the assembled PCR product were circularized by intra-molecular self-ligation in a 1 ml of ligation buffer using T4 DNA ligase (New England Biolabs, Ipswich, MA). The ligation products were cleaned up by removing the enzymes and transformed into 500 μl of electroporation competent TG1 cells (Lucigen, Middleton, WI) to make the library. This method is referred to as EASeL method in this study.