Selected article for: "PCR positive control and positive control"

Author: Spence, Jennifer S.; Krause, Tyler B.; Mittler, Eva; Jangra, Rohit K.; Chandran, Kartik
Title: Direct Visualization of Ebola Virus Fusion Triggering in the Endocytic Pathway
  • Document date: 2016_2_9
  • ID: tnaizwxo_28
    Snippet: Generation of U2OS NPC1-ko cells was carried out by CRISPR/Cas9mediated genome editing (62) using previously described methods (26) . Briefly, a CRISPR guide RNA (gRNA) cloning vector (Addgene plasmid 41824) encoding an NPC1-specific gRNA that targets nucleotides 768 to 790 (5= GGCCTTGTCATTACTTGAGGGGG 3= on the complementary strand) of human NPC1 mRNA was cotransfected along with a plasmid encoding human-codon-optimized endonuclease Cas9 (Addgene.....
    Document: Generation of U2OS NPC1-ko cells was carried out by CRISPR/Cas9mediated genome editing (62) using previously described methods (26) . Briefly, a CRISPR guide RNA (gRNA) cloning vector (Addgene plasmid 41824) encoding an NPC1-specific gRNA that targets nucleotides 768 to 790 (5= GGCCTTGTCATTACTTGAGGGGG 3= on the complementary strand) of human NPC1 mRNA was cotransfected along with a plasmid encoding human-codon-optimized endonuclease Cas9 (Addgene plasmid 41815), a red fluorescent protein expression plasmid (to monitor transfection efficiency), and pMX-IRES-Bla (conferring blasticidin resistance to transfected cells). Following selection of transfected cells by blasticidin treatment, genomic DNA flanking the gRNA target site was amplified by PCR using forward (5= TCATAAACACACCAAACTTG-GAATC 3=) and reverse (5= TCCTGCGGCAGAGGTTTTC 3=) primers and tested for indels by Surveyor assay as previously described (26) . Once genome editing was confirmed at the population level, multiple single-cell clones were isolated for NPC1 gene sequencing. A clonal cell line, NPC1-#6, was found to contain a deletion of 13 nucleotides in both of its NPC1 alleles. The deletion in NPC1-#6 cells is predicted to cause a frame shift at amino acid position 167 that leads to production of a truncated protein of 215 amino acids, in comparison to the 1,278 amino acids of wild-type NPC1. We confirmed the absence of any remaining wild-type NPC1 alleles by reverse transcription-PCR (RT-PCR) using NPC1-F (5= AGGC-CCCCTCAAGTAATGAC 3=, specific for the deleted sequence in the NPC1-knockout cell line) and npc1-R (5= GCCCAAAGTGCTGGT-CAAAG 3=) primers. Amplification of the site-1 protease (S1P) gene using S1P-F (5= GATGTGCTCTGGCAGATGGG 3=) and S1P-R (5= TTTCACGCCAGAACCCCGC 3=) primers was used as a positive control for RT-PCR.

    Search related documents:
    Co phrase search for related documents