Author: Goodman, Laura B.; Anderson, Renee R.; Slater, Marcia; Ortenberg, Elen; Renshaw, Randall W.; Chilson, Brittany D.; Laverack, Melissa A.; Beeby, John S.; Dubovi, Edward J.; Glaser, Amy L.
Title: High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR Document date: 2016_11_28
ID: rd1bxkbu_5
Snippet: 1. Use primer design software to verify that each assay conforms to standard probe-based real-time PCR cycling conditions with 60 °C annealing using the primer probe test tool (select the quantification probe setting with default parameters). NOTE: The representative RNA target used was adapted from the universal influenza A matrix targeted assay published by Shu et al. 7 . The primers and probe are as follows: Forward primer: GACCRATCCTGTCACCTC.....
Document: 1. Use primer design software to verify that each assay conforms to standard probe-based real-time PCR cycling conditions with 60 °C annealing using the primer probe test tool (select the quantification probe setting with default parameters). NOTE: The representative RNA target used was adapted from the universal influenza A matrix targeted assay published by Shu et al. 7 . The primers and probe are as follows: Forward primer: GACCRATCCTGTCACCTCTGAC, Reverse Primer: AGGGCATTYTGGACAAAKCGTCTA, Probe: Fam-TGCAGTCCTCGCTCACTGGGCACG-QSY. The representative DNA assay used here was adapted from the equine herpesvirus type 1 (EHV-1) detection method published by Elia et al. 8 . The primers and probe are as follows: Forward primer: GCTCTCAGGTTTTACGACATC, Reverse Primer: CTTTACCCAGGCCCTTGAAA, Probe: FAM-TCAACGTGGACAATACCGCAGTGATTAT-QSY. 2. Order nanoscale PCR amplification plates in the desired configuration.
Search related documents:
Co phrase search for related documents- detection method and forward primer: 1, 2, 3
- dna assay and probe base: 1, 2
- dna assay and probe primer: 1, 2, 3
- dna assay and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49
- dna assay and representative dna assay: 1
- forward primer and PCR cycling: 1, 2, 3, 4
- forward primer and probe base: 1
- forward primer and probe primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28
- forward primer and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33
- PCR cycling and probe primer: 1, 2, 3, 4
- PCR cycling and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
- PCR cycling condition and real time: 1
- probe base and real time: 1, 2, 3, 4
- probe primer and quantification probe: 1, 2, 3, 4
- probe primer and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77
- probe primer and test tool: 1
- quantification probe and real time: 1, 2, 3, 4
- real time and representative RNA target: 1
- real time and test tool: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21
Co phrase search for related documents, hyperlinks ordered by date