High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Goodman, Laura B.; Anderson, Renee R.; Slater, Marcia; Ortenberg, Elen; Renshaw, Randall W.; Chilson, Brittany D.; Laverack, Melissa A.; Beeby, John S.; Dubovi, Edward J.; Glaser, Amy L.

1. Use primer design software to verify that each assay conforms to standard probe-based real-time PCR cycling conditions with 60 °C annealing using the primer probe test tool (select the quantification probe setting with default parameters). NOTE: The representative RNA target used was adapted from the universal influenza A matrix targeted assay published by Shu et al. 7 . The primers and probe are as follows: Forward primer: GACCRATCCTGTCACCTCTGAC, Reverse Primer: AGGGCATTYTGGACAAAKCGTCTA, Probe: Fam-TGCAGTCCTCGCTCACTGGGCACG-QSY. The representative DNA assay used here was adapted from the equine herpesvirus type 1 (EHV-1) detection method published by Elia et al. 8 . The primers and probe are as follows: Forward primer: GCTCTCAGGTTTTACGACATC, Reverse Primer: CTTTACCCAGGCCCTTGAAA, Probe: FAM-TCAACGTGGACAATACCGCAGTGATTAT-QSY. 2. Order nanoscale PCR amplification plates in the desired configuration.