Selected article for: "genomic dna and PCR amplification"
Author: Gunn, Michael D.; Kyuwa, Shigeru; Tam, Carmen; Kakiuchi, Terutaka; Matsuzawa, Akio; Williams, Lewis T.; Nakano, Hideki
Title: Mice Lacking Expression of Secondary Lymphoid Organ Chemokine Have Defects in Lymphocyte Homing and Dendritic Cell Localization
  • Document date: 1999_2_1
    • ID: sz28ar3t_13
    Snippet: Sequence Analysis. DNA fragments for sequencing were generated by PCR amplification of genomic DNA from ϩ / ϩ and plt mice with the following primer pairs (position of products relative to transcriptional start site is listed in parentheses): GTCAACCTGGTCTATGAATCCCAG and CACGACATC-ACACTGAACCGATC ( Ϫ 1025 to Ϫ 428); GCTCAGCACTTA-TGGAAGGGTG and GCCATGATTGTGGTTGAGTTGAG ( Ϫ 598 to 59); TCTCACCTACAGCTCTGGTCTCATC and GTGAACCACCCAGCTTGAAGTTC (12 to.....
    Document: Sequence Analysis. DNA fragments for sequencing were generated by PCR amplification of genomic DNA from ϩ / ϩ and plt mice with the following primer pairs (position of products relative to transcriptional start site is listed in parentheses): GTCAACCTGGTCTATGAATCCCAG and CACGACATC-ACACTGAACCGATC ( Ϫ 1025 to Ϫ 428); GCTCAGCACTTA-TGGAAGGGTG and GCCATGATTGTGGTTGAGTTGAG ( Ϫ 598 to 59); TCTCACCTACAGCTCTGGTCTCATC and GTGAACCACCCAGCTTGAAGTTC (12 to 779); CTGGA-AAGAAAGGAAAGGGCTC and ATGGAGAGCAGGTTCA-GGTCTTGG (571 to 1046); CTTCAACCATTACATCTG-CACGG and TTTACTCCTGCCTGGGGATAGG (873 to 1965). PCR was performed using a Perkin Elmer 9600 thermal cycler in a final volume of 50 l containing 5 U AmpliTaq enzyme with its 1 ϫ buffer, 0.2 mM of each dNTP, and 1 M of each primer. Samples were heated to 94 Њ C for 4 min, AmpliTaq was added, and samples were cycled for 35 cycles at 94 Њ C for 30 s, 60 Њ C for 1 min, and 72 Њ C for 1 min. PCR products were cloned into PCRII TA (Invitrogen) according to the manufacturer's instructions and sequenced using dye terminator technology.

    Search related documents:
    Co phrase search for related documents
    • dna fragment and PCR amplification: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
    • dna fragment and PCR product: 1, 2, 3, 4, 5, 6, 7
    • dna fragment and sequencing dna fragment: 1, 2, 3, 4, 5, 6, 7, 8
    • dna fragment and start site: 1, 2
    • dye terminator and PCR amplification: 1, 2
    • dye terminator and PCR product: 1, 2
    • dye terminator and primer pair: 1, 2
    • final volume and PCR amplification: 1, 2, 3, 4
    • final volume and PCR product: 1
    • genomic DNA PCR amplification and PCR amplification: 1, 2, 3, 4, 5, 6, 7, 8
    • genomic DNA PCR amplification and PCR product: 1
    • PCR amplification and primer pair: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • PCR amplification and sequencing dna fragment: 1
    • PCR product and primer pair: 1, 2, 3, 4, 5, 6
    • PCR product and start site: 1