Next-Generation Sequencing of Small RNAs from HIV-Infected Cells Identifies Phased microRNA Expression Patterns and Candidate Novel microRNAs Differentially Expressed upon Infection

Chang, Stewart T.; Thomas, Matthew J.; Sova, Pavel; Green, Richard R.; Palermo, Robert E.; Katze, Michael G.

RNA preparation and library construction. Total RNA was extracted using the mirVana kit (Applied Biosystems/Ambion, Austin, TX), and quality and concentration of RNA were determined by an Agilent 2100 Bioanalyzer. Small RNA libraries were prepared with a small RNA version 1.5 sample preparation kit (Illumina, San Diego, CA). Total RNA was ligated with two adaptors: a 3= RNA adaptor specifically modified to target microRNAs (5=-/5rApp/ATCTCGTATGCCGTCTTCTGCTTG/3ddC/) and a 5= RNA adaptor that included the sequencing primer (5=-GUUCAGAGUUCUACAGUCCGACGAUC). Reverse transcription (RT)-PCR amplification was performed using the adaptors as primers. The resulting double-stranded cDNA libraries were purified by polyacrylamide gel electrophoresis using 6% Novex Tris-borate-EDTA gels (Invitrogen, Carlsbad, CA) and size selected to eliminate dimerized adaptors. The quality and concentration of libraries were determined by an Agilent 2100 Bioanalyzer and RiboGreen fluorescence on QuBit (Invitrogen, Carlsbad, CA).