Selected article for: "library construction and quality concentration"

Author: Chang, Stewart T.; Thomas, Matthew J.; Sova, Pavel; Green, Richard R.; Palermo, Robert E.; Katze, Michael G.
Title: Next-Generation Sequencing of Small RNAs from HIV-Infected Cells Identifies Phased microRNA Expression Patterns and Candidate Novel microRNAs Differentially Expressed upon Infection
  • Document date: 2013_2_5
  • ID: t98g8z7i_38
    Snippet: RNA preparation and library construction. Total RNA was extracted using the mirVana kit (Applied Biosystems/Ambion, Austin, TX), and quality and concentration of RNA were determined by an Agilent 2100 Bioanalyzer. Small RNA libraries were prepared with a small RNA version 1.5 sample preparation kit (Illumina, San Diego, CA). Total RNA was ligated with two adaptors: a 3= RNA adaptor specifically modified to target microRNAs (5=-/5rApp/ATCTCGTATGCC.....
    Document: RNA preparation and library construction. Total RNA was extracted using the mirVana kit (Applied Biosystems/Ambion, Austin, TX), and quality and concentration of RNA were determined by an Agilent 2100 Bioanalyzer. Small RNA libraries were prepared with a small RNA version 1.5 sample preparation kit (Illumina, San Diego, CA). Total RNA was ligated with two adaptors: a 3= RNA adaptor specifically modified to target microRNAs (5=-/5rApp/ATCTCGTATGCCGTCTTCTGCTTG/3ddC/) and a 5= RNA adaptor that included the sequencing primer (5=-GUUCAGAGUUCUACAGUCCGACGAUC). Reverse transcription (RT)-PCR amplification was performed using the adaptors as primers. The resulting double-stranded cDNA libraries were purified by polyacrylamide gel electrophoresis using 6% Novex Tris-borate-EDTA gels (Invitrogen, Carlsbad, CA) and size selected to eliminate dimerized adaptors. The quality and concentration of libraries were determined by an Agilent 2100 Bioanalyzer and RiboGreen fluorescence on QuBit (Invitrogen, Carlsbad, CA).

    Search related documents:
    Co phrase search for related documents
    • cdna library and preparation kit: 1
    • cdna library and reverse transcription: 1, 2, 3, 4, 5
    • cdna library and RNA library: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
    • concentration quality and library concentration quality: 1
    • concentration quality and mirVana kit: 1
    • concentration quality and reverse transcription: 1, 2
    • concentration quality and RNA concentration quality: 1, 2, 3, 4, 5
    • concentration quality and RNA library: 1
    • concentration quality and small RNA library: 1
    • double strand and gel electrophoresis: 1, 2
    • double strand and reverse transcription: 1, 2, 3
    • double strand and RNA library: 1