Selected article for: "quality concentration and RNA library"

Author: Chang, Stewart T.; Thomas, Matthew J.; Sova, Pavel; Green, Richard R.; Palermo, Robert E.; Katze, Michael G.
Title: Next-Generation Sequencing of Small RNAs from HIV-Infected Cells Identifies Phased microRNA Expression Patterns and Candidate Novel microRNAs Differentially Expressed upon Infection
  • Document date: 2013_2_5
  • ID: t98g8z7i_38
    Snippet: RNA preparation and library construction. Total RNA was extracted using the mirVana kit (Applied Biosystems/Ambion, Austin, TX), and quality and concentration of RNA were determined by an Agilent 2100 Bioanalyzer. Small RNA libraries were prepared with a small RNA version 1.5 sample preparation kit (Illumina, San Diego, CA). Total RNA was ligated with two adaptors: a 3= RNA adaptor specifically modified to target microRNAs (5=-/5rApp/ATCTCGTATGCC.....
    Document: RNA preparation and library construction. Total RNA was extracted using the mirVana kit (Applied Biosystems/Ambion, Austin, TX), and quality and concentration of RNA were determined by an Agilent 2100 Bioanalyzer. Small RNA libraries were prepared with a small RNA version 1.5 sample preparation kit (Illumina, San Diego, CA). Total RNA was ligated with two adaptors: a 3= RNA adaptor specifically modified to target microRNAs (5=-/5rApp/ATCTCGTATGCCGTCTTCTGCTTG/3ddC/) and a 5= RNA adaptor that included the sequencing primer (5=-GUUCAGAGUUCUACAGUCCGACGAUC). Reverse transcription (RT)-PCR amplification was performed using the adaptors as primers. The resulting double-stranded cDNA libraries were purified by polyacrylamide gel electrophoresis using 6% Novex Tris-borate-EDTA gels (Invitrogen, Carlsbad, CA) and size selected to eliminate dimerized adaptors. The quality and concentration of libraries were determined by an Agilent 2100 Bioanalyzer and RiboGreen fluorescence on QuBit (Invitrogen, Carlsbad, CA).

    Search related documents:
    Co phrase search for related documents
    • cdna library and preparation kit: 1
    • cdna library and reverse transcription: 1, 2, 3, 4, 5
    • concentration quality and library concentration quality: 1
    • concentration quality and mirVana kit: 1
    • concentration quality and reverse transcription: 1, 2
    • concentration quality and RNA concentration quality: 1, 2, 3, 4, 5
    • double strand and gel electrophoresis: 1, 2
    • double strand and reverse transcription: 1, 2, 3
    • gel electrophoresis and library preparation: 1
    • gel electrophoresis and preparation kit: 1
    • gel electrophoresis and reverse transcription: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • library concentration quality and RNA concentration quality: 1
    • library preparation and mirVana kit: 1
    • library preparation and preparation kit: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
    • library preparation and reverse transcription: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
    • library preparation and RNA adaptor: 1
    • mirVana kit and RNA concentration quality: 1
    • preparation kit and reverse transcription: 1, 2, 3, 4