Selected article for: "complementary deoxyribonucleic acid and PCR real time polymerase chain reaction"

Author: Cao, Rui-Yuan; Xu, Yong-fen; Zhang, Tian-Hong; Yang, Jing-Jing; Yuan, Ye; Hao, Pei; Shi, Yi; Zhong, Jin; Zhong, Wu
Title: Pediatric Drug Nitazoxanide: A Potential Choice for Control of Zika
  • Document date: 2017_2_3
  • ID: sbf9qi6g_7
    Snippet: Ribonucleic acid was extracted using QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer's protocol. Complementary deoxyribonucleic acid (cDNA) was synthesized using ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Ribonucleic acid was quantified using real-time polymerase chain reaction (PCR) with an Applied Biosystems 7300 real-time PCR system. Real-time PCR was performed using 2 μL of cDNA with specific primers targ.....
    Document: Ribonucleic acid was extracted using QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer's protocol. Complementary deoxyribonucleic acid (cDNA) was synthesized using ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Ribonucleic acid was quantified using real-time polymerase chain reaction (PCR) with an Applied Biosystems 7300 real-time PCR system. Real-time PCR was performed using 2 μL of cDNA with specific primers targeting the genes of interest (β-actin, forward, AGTGTGACGTGGACATCCGCAAAG and reverse, ATCCACATCTGCTGGAAGGTGGAC; ZIKV, forward, CAACTACTGCAAGTGGAAGGGT and reverse, AAGTGGTCCATATGATCGGTTGA) and 5 μL of quantitative PCR SYBR Green real-time PCR Master Mix (Toyobo) in a final reaction volume of 10 μL. The cycling conditions were 45 cycles of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 30 seconds. Messenger RNA (mRNA) expression (fold induction) was quantified by calculating the 2 −ΔCT value, with β-actin mRNA as an endogenous control.

    Search related documents:
    Co phrase search for related documents