Author: Ma, Ge; Greenwell-Wild, Teresa; Lei, Kejian; Jin, Wenwen; Swisher, Jennifer; Hardegen, Neil; Wild, Carl T.; Wahl, Sharon M.
Title: Secretory Leukocyte Protease Inhibitor Binds to Annexin II, a Cofactor for Macrophage HIV-1 Infection Document date: 2004_11_15
ID: rlabxfss_11
Snippet: Small Interfering RNA (siRNA) Inhibition of Annexin II. Annexin II siRNA 1 and 2 were synthesized based on the sequence r(GCACUGAAGUCAGCCUUAUUU)/r(AUAAGGCUG -ACUUCAGUGCUG) and r(CGGUGAUUUUGGGCCUAU-UUU)/r(AAUAGGCCCAAAAUCACCGUC; QIAGEN). An unrelated control siRNA was also purchased from QIAGEN. SiRNA was transfected into monocytes using the Amaxa Human Dendritic Cell Nucleofector kit following the protocol for nucleofection of suspension cells. Th.....
Document: Small Interfering RNA (siRNA) Inhibition of Annexin II. Annexin II siRNA 1 and 2 were synthesized based on the sequence r(GCACUGAAGUCAGCCUUAUUU)/r(AUAAGGCUG -ACUUCAGUGCUG) and r(CGGUGAUUUUGGGCCUAU-UUU)/r(AAUAGGCCCAAAAUCACCGUC; QIAGEN). An unrelated control siRNA was also purchased from QIAGEN. SiRNA was transfected into monocytes using the Amaxa Human Dendritic Cell Nucleofector kit following the protocol for nucleofection of suspension cells. The cells were incubated 6 d before analysis of annexin protein by Western blot and infection with HIV-1.
Search related documents:
Co phrase search for related documents- annexin protein and western blot: 1, 2, 3, 4
- infection western blot and western blot: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- sequence base and western blot: 1
Co phrase search for related documents, hyperlinks ordered by date