Selected article for: "dendritic cell and human cell"

Author: Ma, Ge; Greenwell-Wild, Teresa; Lei, Kejian; Jin, Wenwen; Swisher, Jennifer; Hardegen, Neil; Wild, Carl T.; Wahl, Sharon M.
Title: Secretory Leukocyte Protease Inhibitor Binds to Annexin II, a Cofactor for Macrophage HIV-1 Infection
  • Document date: 2004_11_15
  • ID: rlabxfss_11
    Snippet: Small Interfering RNA (siRNA) Inhibition of Annexin II. Annexin II siRNA 1 and 2 were synthesized based on the sequence r(GCACUGAAGUCAGCCUUAUUU)/r(AUAAGGCUG -ACUUCAGUGCUG) and r(CGGUGAUUUUGGGCCUAU-UUU)/r(AAUAGGCCCAAAAUCACCGUC; QIAGEN). An unrelated control siRNA was also purchased from QIAGEN. SiRNA was transfected into monocytes using the Amaxa Human Dendritic Cell Nucleofector kit following the protocol for nucleofection of suspension cells. Th.....
    Document: Small Interfering RNA (siRNA) Inhibition of Annexin II. Annexin II siRNA 1 and 2 were synthesized based on the sequence r(GCACUGAAGUCAGCCUUAUUU)/r(AUAAGGCUG -ACUUCAGUGCUG) and r(CGGUGAUUUUGGGCCUAU-UUU)/r(AAUAGGCCCAAAAUCACCGUC; QIAGEN). An unrelated control siRNA was also purchased from QIAGEN. SiRNA was transfected into monocytes using the Amaxa Human Dendritic Cell Nucleofector kit following the protocol for nucleofection of suspension cells. The cells were incubated 6 d before analysis of annexin protein by Western blot and infection with HIV-1.

    Search related documents:
    Co phrase search for related documents