Author: Yu, Chien-Hung; Noteborn, Mathieu H.; Pleij, Cornelis W. A.; Olsthoorn, René C. L.
Title: Stem–loop structures can effectively substitute for an RNA pseudoknot in -1 ribosomal frameshifting Document date: 2011_7_29
ID: wifs97yy_7
Snippet: Mutations in the SRV-1 gag-pro frameshifting signal were made in an abridged version of plasmid SF2 (25) which is derivative of pSFCASS5 (26), a frameshift reporter construct. In this version, the entire BglII-NcoI fragment of pSF2 was replaced by a synthetic dsDNA fragment (5 0 -G ATCTTAATACGACTCACTATAGGGCTCATTTAA ACTAGTTGAGGGGCCATATTTCGC-3 0 , a SpeI restriction site is underlined). This yielded plasmid pSF208 in which the original GGGAAAC slip.....
Document: Mutations in the SRV-1 gag-pro frameshifting signal were made in an abridged version of plasmid SF2 (25) which is derivative of pSFCASS5 (26), a frameshift reporter construct. In this version, the entire BglII-NcoI fragment of pSF2 was replaced by a synthetic dsDNA fragment (5 0 -G ATCTTAATACGACTCACTATAGGGCTCATTTAA ACTAGTTGAGGGGCCATATTTCGC-3 0 , a SpeI restriction site is underlined). This yielded plasmid pSF208 in which the original GGGAAAC slippery sequence has been replaced by the more slippery UUUAAAC sequence (26) . pSF208 was digested with SpeI and NcoI, and sets of complementary oligonucleotides corresponding to the various mutants were inserted. A list of oligonucleotides is available upon request. All constructs were verified by automated dideoxy sequencing using chain terminator dyes (LGTC, Leiden).
Search related documents:
Co phrase search for related documents- frameshift reporter and slippery UUUAAAC sequence: 1
- frameshifting signal and GGGAAAC slippery sequence: 1
- frameshifting signal and slippery sequence: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
- frameshifting signal and slippery UUUAAAC sequence: 1
- GGGAAAC slippery sequence and slippery sequence: 1, 2
Co phrase search for related documents, hyperlinks ordered by date