Author: Peña, José; Chen-Harris, Haiyin; Allen, Jonathan E.; Hwang, Mona; Elsheikh, Maher; Mabery, Shalini; Bielefeldt-Ohmann, Helle; Zemla, Adam T.; Bowen, Richard A.; Borucki, Monica K.
Title: Sendai virus intra-host population dynamics and host immunocompetence influence viral virulence during in vivo passage Document date: 2016_4_9
ID: z7f720dj_18
Snippet: Approximately 15.1 kb of the virus genome was amplified using degenerate primers (Supplementary Table S1 ). Primers were designed to be as sensitive to target strain variants as possible, while still being specific enough to not cross-react with non-targets as described previously in Slezak et al. (2003) and Borucki et al. (2013) . The Taqman primers/probe used for quantification of viral genomes was SeV511F: CAGAATGGCTGTTTGGACCT, SeV640R: CTTCAC.....
Document: Approximately 15.1 kb of the virus genome was amplified using degenerate primers (Supplementary Table S1 ). Primers were designed to be as sensitive to target strain variants as possible, while still being specific enough to not cross-react with non-targets as described previously in Slezak et al. (2003) and Borucki et al. (2013) . The Taqman primers/probe used for quantification of viral genomes was SeV511F: CAGAATGGCTGTTTGGACCT, SeV640R: CTTCACCAGCACAATCCAGA, SeV604probe: GGTAT CCTGCATGCCTAGGA.
Search related documents:
Co phrase search for related documents- degenerate primer and virus genome: 1
- non target and strain variant: 1
- non target and viral genome: 1, 2, 3, 4
- non target and virus genome: 1, 2, 3, 4, 5
- previously describe and viral genome: 1, 2
- previously describe and virus genome: 1
- strain variant and viral genome: 1, 2, 3, 4
- strain variant and virus genome: 1, 2, 3, 4, 5, 6, 7, 8
- viral genome and virus genome: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78
- viral genome quantification and virus genome: 1, 2
Co phrase search for related documents, hyperlinks ordered by date