Selected article for: "cell surface and IFN induction"

Author: Wang, Yi; Liu, Li
Title: The Membrane Protein of Severe Acute Respiratory Syndrome Coronavirus Functions as a Novel Cytosolic Pathogen-Associated Molecular Pattern To Promote Beta Interferon Induction via a Toll-Like-Receptor-Related TRAF3-Independent Mechanism
  • Document date: 2016_2_9
  • ID: uf96jgig_24
    Snippet: In summary, the current study demonstrates for the first time that the M protein of SARS-CoV is able to function as a cytosolic PAMP to promote IFN-␤ production by activating a TLR-related TRAF3-independent pathway. The driving force for M-mediated IFN-␤ induction is likely generated from inside the cells rather than the extracellular binding of M proteins with the defined cell surface PRRs, such as TLR4. Plasmid construction. Plasmids pCMV-M.....
    Document: In summary, the current study demonstrates for the first time that the M protein of SARS-CoV is able to function as a cytosolic PAMP to promote IFN-␤ production by activating a TLR-related TRAF3-independent pathway. The driving force for M-mediated IFN-␤ induction is likely generated from inside the cells rather than the extracellular binding of M proteins with the defined cell surface PRRs, such as TLR4. Plasmid construction. Plasmids pCMV-Myc-M and pBS-U6-siM1 were constructed previously (26) . Plasmids pCMV-Myc-S and pCMV-Myc-E were constructed by inserting S and E into the EcoRI and KpnI sites of pCMV-Myc. The mutant of pCMV-Myc-M(V68A) was generated by using the site-directed mutagenesis kit (TaKaRa, Dalian, China). One copy of the IFN-␤ promoter sequence (5=-CTAAAATGTAAATGACATA GGAAAACTGAAAGGGAGAAGTGAAAGTGGGAAATTCCTCTGAAT AGAGAGAGGACCATCTCATATAAATAGGCCATACCCATGGAGAA AGGACATTCTAACTGCAACCTTTCGA-3=) was PCR amplified and subcloned into the KpnI and XhoI sites of the luciferase reporter pGL3basic (Promega, Madison, WI, USA) to generate the pGL3-IFN-␤-luc construct. All primers were synthesized by Sangon (Shanghai, China). For the construction of pBS/U6 siTBK1, the sense strand 5= TCGAGTTGCG AAGCCGGAAGTGTCCTAAGCTTAGGACACTTCCGGCTTCGCAAT TTTTG 3= and antisense strand 5= ACGCTTCGGCCTTCACAGGATTC GAATCCTGTGAAGGCCGAAGCGTTAAAAACTTAA 3= were annealed and then subcloned into the EcoRI and XhoI sites of pBS/U6. For the construction of pBS/U6 siIRF3, the sense strand 5= TCGAGCATCGGCT TTTGGGTCTGTTAAAGCTTTAACAGACCCAAAAGCCGATGTTTT TG 3= and antisense strand 5= CGTAGCCGAAAACCCAGACAATTTCG AAATTGTCTGGGTTTTCGGCTACAAAAACTTAA 3= were annealed and then subcloned into the EcoRI and XhoI sites of pBS/U6.

    Search related documents:
    Co phrase search for related documents
    • cell surface and define cell surface: 1
    • cell surface and extracellular binding: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • cell surface and luciferase reporter: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • cell surface and previously construct: 1
    • cell surface and production promote: 1, 2
    • cell surface and promoter sequence: 1
    • cell surface and site direct: 1, 2
    • construct generate and luciferase reporter: 1
    • construct generate and previously construct: 1
    • construct generate and promoter sequence: 1
    • current study and cytosolic PAMP function: 1
    • current study and extracellular binding: 1
    • current study and luciferase reporter: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • current study and PCR amplify: 1, 2
    • current study and promoter sequence: 1