trans-Golgi retention of a plasma membrane protein: mutations in the cytoplasmic domain of the asialoglycoprotein receptor subunit H1 result in trans-Golgi retention

To construct HIT, the cDNA corresponding to the cytoplasmic domain of the mouse transferrin receptor (from L. Kithn, ISREC) was amplified by PCR from the plasmid pMTR-1 using the mutagenic primer TCC-CCAGTCGACCATTAAAC, which introduces a SalI site (underlined) at the end, and a primer corresponding to a flanking sequence in the plasmid vector. The cDNA corresponding to the transmembrane and exoplasmic domains of H1 were amplified similarly with the primer CCGGAC-GTCGACTCCTCCTG, which introduces a SalI site at the beginning of the transmembrane domain. The PCR products were subcloned and ligated to each other at the SalI site. The eDNA of H1TA was constructed by PCR from the plasmid encoding HIT using the mutagenic primer GGGGTACCATGGTCAGAAAACCCAAGAGG to amplify a truncated eDNA with a 5' ATG and a KpnI restriction site for subcloning.