Selected article for: "previous study and RNA seq"

Author: Chang Liu; Ze Chen; Wenyuan Shen; Deshui Yu; Siyu Li; Yue Hu; Haishuo Ji; Wenjun Bu; Qingsong Wang; Shan Gao
Title: Complemented palindrome small RNAs first discovered from SARS coronavirus
  • Document date: 2017_9_7
  • ID: g55d5ijx_3
    Snippet: invertebrates [5] . In 2016, Wang et al. first used sRNA-seq data from the NCBI SRA database to prove that 62 sRNA-seq can be used to detect and identify human viruses [6] , but the detection results were not as good as 63 those of plant or invertebrate viruses. To improve virus detection in mammals, our strategy was to detect and 64 compare featured RNA fragments in plants, invertebrates and mammals using sRNA-seq data. In one 65 previous study .....
    Document: invertebrates [5] . In 2016, Wang et al. first used sRNA-seq data from the NCBI SRA database to prove that 62 sRNA-seq can be used to detect and identify human viruses [6] , but the detection results were not as good as 63 those of plant or invertebrate viruses. To improve virus detection in mammals, our strategy was to detect and 64 compare featured RNA fragments in plants, invertebrates and mammals using sRNA-seq data. In one 65 previous study [7] , we detected siRNA duplexes induced by plant viruses and analyzed these siRNA 66 duplexes as an important class of featured RNA fragments. In this study, we detected siRNA duplexes 67 induced by invertebrate and mammal viruses a n d unexpectedly discovered another important class of 68 featured RNA fragments, which were complemented palindrome small RNAs (cpsRNAs). Among all the 69 detected cpsRNAs, we found a typical 22-nt cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS 70 coronavirus (SARS-CoV) strain MA15, which deserved further studies because mice infected with SARS-71

    Search related documents:
    Co phrase search for related documents
    • detection result and previous study: 1
    • detection result and virus detection: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16