Selected article for: "dhfr sequence and p62 signal"

Title: The signal sequence of the p62 protein of Semliki Forest virus is involved in initiation but not in completing chain translocation
  • Document date: 1990_9_1
  • ID: rmjv56ia_17
    Snippet: Construction of Plasmidp62dhfr. For engineering of a p62 protein signal sequence-dhfr fusion protein which is not derived from a C proteincontaining precursor we synthesized the whole p62 signal sequence region. Two overlapping oligonucleotides were made (DNA-synthesizer; Applied Biosystems, Foster City, CA) :(1) 5' ATACACAGAATTCAGCACCATGT-CCGCCCCGCTGATTAC TGCCATGTGTGTCCTIV~CAATC_~TACCT-TCCCGTC~TTCCAGCCCCCGTGTGTACC~, (2) 5' GTTATCCT-CGAGCATCCGTAG.....
    Document: Construction of Plasmidp62dhfr. For engineering of a p62 protein signal sequence-dhfr fusion protein which is not derived from a C proteincontaining precursor we synthesized the whole p62 signal sequence region. Two overlapping oligonucleotides were made (DNA-synthesizer; Applied Biosystems, Foster City, CA) :(1) 5' ATACACAGAATTCAGCACCATGT-CCGCCCCGCTGATTAC TGCCATGTGTGTCCTIV~CAATC_~TACCT-TCCCGTC~TTCCAGCCCCCGTGTGTACC~, (2) 5' GTTATCCT-CGAGCATCCGTAGTGTGGCCTCTGCGTTGTTTTCATAGCAGCA-AGGTACACACGGGGGC TGGAAGCAC GGGAAGGTAGCATTGCJCA-AGGAC. They correspond to both strands of the p62 signal sequence region of the SFV eDNA. Together they span the coding region of amino acid residues 1-40 of p62. Oligo 1 (the coding strand) includes, in addition, the region coding for initiator methionine of the C protein plus its 5' flanking sequences (5' AGCACCATG). At the extreme 5' end of this oligo we have added the recognition sequence for Eco RI and its flanking sequences from the 5' end of the structural part of the SFV cDNA (5' ATACACAGATTC). Oligo 2 ends at its 3' end with the Xho I site which follows the signal sequence region on the p62 gene.

    Search related documents:
    Co phrase search for related documents
    • amino acid and flank sequence: 1
    • amino acid and initiator methionine: 1
    • amino acid and oligo end: 1
    • amino acid residue and code region: 1