Zinc Deficiency-Like Syndrome in Fleckvieh Calves: Clinical and Pathological Findings and Differentiation from Bovine Hereditary Zinc Deficiency

Langenmayer, M.C.; Jung, S.; Majzoub-Altweck, M.; Trefz, F.M.; Seifert, C.; Knubben-Schweizer, G.; Fries, R.; Hermanns, W.; Gollnick, N.S.

Archive cases of Fleckvieh calves under the age of 8 months with a history of crusting dermatitis or suspected zinc deficiency were identified and the histology reviewed. For genomic DNA isolation, 10 mm sections of these archival formalin-fixed paraffinembedded (FFPE) tissue samples were deparaffinized 3 3 20 minutes in xylene and rehydrated in a graded ethanol series for 2 3 15 minutes. After, sections were incubated overnight in 1x PK-buffer (20 mM Tris-HCl, 4 mM EDTA, 100 mM NaCl), 10% SDS and 2 mL Proteinase K (20 mg/mL) at 568C followed by phenol-chloroform-DNA-extraction. For up-concentration, DNA was alcohol-precipitated and redissolved and diluted in 13 TE-buffer. The published PLD4-variant 3 was polymerase chain reaction (PCR)-amplified with 2 separated primersystems resulting in a 244 and 426 bp fragment, respectively (1-for: CCTCCTTCTCCCACCTGTAA/1-rev: TTACAGACCTGCCTCCATCC and 2-for: CTTGTCAGGTGCCCAGGT/2-rev: TTACAGACCTGCCTC CATCC). Polymerase chain reaction products were enzymatically purified and sequencing reactions were done for both strands with BigDye Terminator v1.1 Cycle Sequencing Kit. b Electrophoresis of purified sequencing reactions was performed on the ABI 3130xl Genetic Analyzer. c The Phred/Phrap/Polyphred software suite [11] [12] [13] was used for base calling, sequence alignment, and polymorphism detection. Sequences were viewed with Consed. 14 To avoid false results because of DNA desamination, amplification reactions were performed repeatedly.