Author: Langenmayer, M.C.; Jung, S.; Majzoub-Altweck, M.; Trefz, F.M.; Seifert, C.; Knubben-Schweizer, G.; Fries, R.; Hermanns, W.; Gollnick, N.S.
Title: Zinc Deficiency-Like Syndrome in Fleckvieh Calves: Clinical and Pathological Findings and Differentiation from Bovine Hereditary Zinc Deficiency Document date: 2018_2_9
ID: qui29pis_8
Snippet: Archive cases of Fleckvieh calves under the age of 8 months with a history of crusting dermatitis or suspected zinc deficiency were identified and the histology reviewed. For genomic DNA isolation, 10 mm sections of these archival formalin-fixed paraffinembedded (FFPE) tissue samples were deparaffinized 3 3 20 minutes in xylene and rehydrated in a graded ethanol series for 2 3 15 minutes. After, sections were incubated overnight in 1x PK-buffer (.....
Document: Archive cases of Fleckvieh calves under the age of 8 months with a history of crusting dermatitis or suspected zinc deficiency were identified and the histology reviewed. For genomic DNA isolation, 10 mm sections of these archival formalin-fixed paraffinembedded (FFPE) tissue samples were deparaffinized 3 3 20 minutes in xylene and rehydrated in a graded ethanol series for 2 3 15 minutes. After, sections were incubated overnight in 1x PK-buffer (20 mM Tris-HCl, 4 mM EDTA, 100 mM NaCl), 10% SDS and 2 mL Proteinase K (20 mg/mL) at 568C followed by phenol-chloroform-DNA-extraction. For up-concentration, DNA was alcohol-precipitated and redissolved and diluted in 13 TE-buffer. The published PLD4-variant 3 was polymerase chain reaction (PCR)-amplified with 2 separated primersystems resulting in a 244 and 426 bp fragment, respectively (1-for: CCTCCTTCTCCCACCTGTAA/1-rev: TTACAGACCTGCCTCCATCC and 2-for: CTTGTCAGGTGCCCAGGT/2-rev: TTACAGACCTGCCTC CATCC). Polymerase chain reaction products were enzymatically purified and sequencing reactions were done for both strands with BigDye Terminator v1.1 Cycle Sequencing Kit. b Electrophoresis of purified sequencing reactions was performed on the ABI 3130xl Genetic Analyzer. c The Phred/Phrap/Polyphred software suite [11] [12] [13] was used for base calling, sequence alignment, and polymorphism detection. Sequences were viewed with Consed. 14 To avoid false results because of DNA desamination, amplification reactions were performed repeatedly.
Search related documents:
Co phrase search for related documents- polymerase chain reaction and Sequencing kit: 1, 2, 3, 4, 5, 6, 7, 8
- polymerase chain reaction and sequencing reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76
- polymerase chain reaction and tissue sample: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
- polymerase chain reaction and zinc deficiency: 1
- polymerase chain reaction product and sequence alignment: 1
- polymorphism detection and sequence alignment: 1, 2
- polymorphism detection and software suite: 1
- sequence alignment and software suite: 1, 2, 3
- sequence alignment and tissue sample: 1
- Sequencing kit and tissue sample: 1
Co phrase search for related documents, hyperlinks ordered by date