Selected article for: "dna extraction and PCR reaction"

Author: Langenmayer, M.C.; Jung, S.; Majzoub-Altweck, M.; Trefz, F.M.; Seifert, C.; Knubben-Schweizer, G.; Fries, R.; Hermanns, W.; Gollnick, N.S.
Title: Zinc Deficiency-Like Syndrome in Fleckvieh Calves: Clinical and Pathological Findings and Differentiation from Bovine Hereditary Zinc Deficiency
  • Document date: 2018_2_9
  • ID: qui29pis_8
    Snippet: Archive cases of Fleckvieh calves under the age of 8 months with a history of crusting dermatitis or suspected zinc deficiency were identified and the histology reviewed. For genomic DNA isolation, 10 mm sections of these archival formalin-fixed paraffinembedded (FFPE) tissue samples were deparaffinized 3 3 20 minutes in xylene and rehydrated in a graded ethanol series for 2 3 15 minutes. After, sections were incubated overnight in 1x PK-buffer (.....
    Document: Archive cases of Fleckvieh calves under the age of 8 months with a history of crusting dermatitis or suspected zinc deficiency were identified and the histology reviewed. For genomic DNA isolation, 10 mm sections of these archival formalin-fixed paraffinembedded (FFPE) tissue samples were deparaffinized 3 3 20 minutes in xylene and rehydrated in a graded ethanol series for 2 3 15 minutes. After, sections were incubated overnight in 1x PK-buffer (20 mM Tris-HCl, 4 mM EDTA, 100 mM NaCl), 10% SDS and 2 mL Proteinase K (20 mg/mL) at 568C followed by phenol-chloroform-DNA-extraction. For up-concentration, DNA was alcohol-precipitated and redissolved and diluted in 13 TE-buffer. The published PLD4-variant 3 was polymerase chain reaction (PCR)-amplified with 2 separated primersystems resulting in a 244 and 426 bp fragment, respectively (1-for: CCTCCTTCTCCCACCTGTAA/1-rev: TTACAGACCTGCCTCCATCC and 2-for: CTTGTCAGGTGCCCAGGT/2-rev: TTACAGACCTGCCTC CATCC). Polymerase chain reaction products were enzymatically purified and sequencing reactions were done for both strands with BigDye Terminator v1.1 Cycle Sequencing Kit. b Electrophoresis of purified sequencing reactions was performed on the ABI 3130xl Genetic Analyzer. c The Phred/Phrap/Polyphred software suite [11] [12] [13] was used for base calling, sequence alignment, and polymorphism detection. Sequences were viewed with Consed. 14 To avoid false results because of DNA desamination, amplification reactions were performed repeatedly.

    Search related documents:
    Co phrase search for related documents
    • amplification reaction and chain reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • amplification reaction and chain reaction product: 1, 2, 3, 4
    • amplification reaction and chloroform dna: 1
    • amplification reaction and false result: 1
    • BigDye Terminator Cycle Sequencing kit and chain reaction: 1, 2, 3
    • BigDye Terminator Cycle Sequencing kit and Cycle Sequencing kit: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • bp fragment and chain reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23
    • chain reaction and chloroform dna: 1, 2
    • chain reaction and Cycle Sequencing kit: 1, 2, 3, 4
    • chain reaction and dna isolation: 1, 2, 3, 4
    • chain reaction and false result: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22