Gain-of-function experiments with bacteriophage lambda uncover residues under diversifying selection in nature

Maddamsetti, Rohan; Johnson, Daniel T.; Spielman, Stephanie J.; Petrie, Katherine L.; Marks, Debora S.; Meyer, Justin R.

We constructed two separate libraries. For the first, 18 rounds of MAGE were used to create a combinatorial library of 10 commonly evolved J mutations. We screened for OmpF + isolates by plating on a lawn of lamB-deleted E. coli (JW3996 from the KEIO collection (Baba et al. 2006 )), and then sequencing 33 randomly chosen plaques. We only sequenced the C-terminus of the J gene with the Sanger method. Unpurified PCR products (Forward primer: 5 CGCATCGTTCACCTCTCACT; Reverse primer: 5 CCTGCGGGCGGTTTGTCATTT) were submitted to the Genewiz La Jolla, CA facility for sequencing. One isolate had all 10 mutations, indicating that 18 rounds was sufficient to generate even the most unlikely genotype. Twelve unique genotypes were uncovered among the 33 isolates sequenced.