Selected article for: "RNA sample and total RNA sample"

Author: Wu, Huajie; Li, Yan; Wang, Yanxia; Xu, Dunquan; Li, Congcong; Liu, Manling; Sun, Xin; Li, Zhichao
Title: Tanshinone IIA Attenuates Bleomycin-Induced Pulmonary Fibrosis via Modulating Angiotensin-Converting Enzyme 2/ Angiotensin-(1-7) Axis in Rats
  • Document date: 2014_4_7
  • ID: td2uk2wc_15
    Snippet: Total RNA of rat lung tissue was extracted by using Trizol agent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized by a M-MLV reverse transcripase kits (BestBio Inc, Shanghai, China) from 2.5 µg per sample of total RNA according to the manufacturer's instructions. The primer pairs were designed by primer premier 5 (PREMIER Biosoft International, Palo Alto CA, USA), and original infor-mation of cDNA were aligned in the GeneBank. .....
    Document: Total RNA of rat lung tissue was extracted by using Trizol agent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized by a M-MLV reverse transcripase kits (BestBio Inc, Shanghai, China) from 2.5 µg per sample of total RNA according to the manufacturer's instructions. The primer pairs were designed by primer premier 5 (PREMIER Biosoft International, Palo Alto CA, USA), and original infor-mation of cDNA were aligned in the GeneBank. The primers were checked and synthesized by Genescript Company (Nangjing, China). The primer pairs for TGFβ1 are GAAGACATGACCCTGCTGGTGA (forward chain) and CTGGTGCTCTGGGCACTTGA (reverse chain); ACE-2 are AATCGTAGGCTCTGGGCTTGG (forward chain) and TTCGATCAACTGGTTTCGGTTGTA (reverse chain).

    Search related documents:
    Co phrase search for related documents
    • forward chain and reverse chain: 1
    • lung tissue and rat lung tissue: 1, 2, 3, 4, 5, 6
    • lung tissue and reverse chain: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
    • lung tissue and total RNA sample: 1
    • primer pair and reverse chain: 1, 2, 3, 4, 5, 6
    • reverse chain and total RNA sample: 1, 2, 3, 4