Yeast Kex1p is a Golgi-associated membrane protein: deletions in a cytoplasmic targeting domain result in mislocalization to the vacuolar membrane

The aberrant stop mutation (AS) was identified while sequencing potential AMS clones. The AS clone contained a mutation at both bp1823 and bp1824, introducing a premature stop codon at codon 608. The Hpa mutation was to introduce an arginine residue immediately after the membranespanning domain followed by a termination codon using the mutagenic oligonucleotide 5' GGAGTTTATGCGTATCGTTAACGATAGAAGAGTGA 3'. To aid in identifying mutant clones an HpaI site was introduced by the mntagenesis. All derivatives of the Hpa mutagenesis were subsequently sequenced and found to have undergone a 2-bp deletion (A1908-1909 bp) upstream from the inserted termination codon resulting in the mutation shown in Fig. 3 . The Bcl mutation introduced a BclI cleavage site (5' GTTTAT-GCGTATGATTGATCAGTGAGGAGAAAAG 31 immediately after the aspartate residue (codon No. 637) which borders the carboxy-terminal portion of the membrane-spanning domain. The Hinc mutation introduced a termination codon 20 amino acid residues carboxy-terminal to the membrane-spanning domain using the mutagenic oligonucleotide 5' CCAAAT-AATAGTTAACATGACAGT 3'. To aid in identifying mutant clones an HinclI site was introduced by the mutagenesis. Introduction of the various KEX/mutations into pVTI03-L produced the following plasmids: pKXI-18AS, pKXl-18Hpa, pKXI-18Bel, and pKXl-18Hinc.