Selected article for: "PCR primer and reverse primer"

Author: Ma, Ge; Greenwell-Wild, Teresa; Lei, Kejian; Jin, Wenwen; Swisher, Jennifer; Hardegen, Neil; Wild, Carl T.; Wahl, Sharon M.
Title: Secretory Leukocyte Protease Inhibitor Binds to Annexin II, a Cofactor for Macrophage HIV-1 Infection
  • Document date: 2004_11_15
  • ID: rlabxfss_10
    Snippet: RT-PCR. Total cellular RNA was extracted using the RNeasy minikit (QIAGEN). 2 g RNA was reverse transcribed by oligodeoxythymidylic acid primer (Promega) and the resulting 1 l cDNA was amplified by PCR. The primer sets for annexin II were ATGTCTACTGTTCACGAAATC (sense) and AAT-GAGAGAGTCCTCGTCGG (antisense). For normalization, GAPDH primer sets were GTGAAGGTCGGGAGTCAACG-GATTT (sense) and CACAGTCTTCTGGGTGGCAGTGAT (antisense). PCR was performed using.....
    Document: RT-PCR. Total cellular RNA was extracted using the RNeasy minikit (QIAGEN). 2 g RNA was reverse transcribed by oligodeoxythymidylic acid primer (Promega) and the resulting 1 l cDNA was amplified by PCR. The primer sets for annexin II were ATGTCTACTGTTCACGAAATC (sense) and AAT-GAGAGAGTCCTCGTCGG (antisense). For normalization, GAPDH primer sets were GTGAAGGTCGGGAGTCAACG-GATTT (sense) and CACAGTCTTCTGGGTGGCAGTGAT (antisense). PCR was performed using 1.5 mM MgCl 2 , 200 M deoxynucleoside triphosphates, 10 pmol of each primer, and 1 U Taq polymerase (Invitrogen). cDNA was amplified for 25 cycles with the following settings: 94 Њ C for 30 s, 55 Њ C for 30 s, and 68 Њ C for 30 s.

    Search related documents:
    Co phrase search for related documents
    • PCR amplify and primer set: 1, 2
    • QIAGEN RNeasy minikit and RNeasy minikit: 1, 2, 3, 4, 5, 6