Selected article for: "RNA template stem loop and template stem loop"

Author: Ramya Rangan; Andrew M. Watkins; Wipapat Kladwang; Rhiju Das
Title: De novo 3D models of SARS-CoV-2 RNA elements and small-molecule-binding RNAs to guide drug discovery
  • Document date: 2020_4_15
  • ID: 7gm92gau_26
    Snippet: The DNA template for stem-loop 5 RNA was amplified from a gBlock sequence for the extended 5′ UTR (primers and gBlock sequences ordered from Integrated DNA Technologies, sequences in Table S1 ). The primers were designed to add a Phi2.5 promoter sequence (TTCTAATACGACTCACTATT) at the amplicon's 5' end and a 20 base-pair Tail2 sequence (AAAGAAACAACAACAACAAC) at its 3' end. The PCR reaction contained 5 ng of gBlock DNA template, 2 μM of forward .....
    Document: The DNA template for stem-loop 5 RNA was amplified from a gBlock sequence for the extended 5′ UTR (primers and gBlock sequences ordered from Integrated DNA Technologies, sequences in Table S1 ). The primers were designed to add a Phi2.5 promoter sequence (TTCTAATACGACTCACTATT) at the amplicon's 5' end and a 20 base-pair Tail2 sequence (AAAGAAACAACAACAACAAC) at its 3' end. The PCR reaction contained 5 ng of gBlock DNA template, 2 μM of forward and reverse primer, 0.2 mM of dNTPs, 2 units of DNA Phusion DNA polymerase, and 1X of HF buffer. The reaction was first denatured at 98 °C for 30 s. Then for 35 cycles, the sample was denatured at 98 °C for 10 sec, annealed at 64 °C for 30 sec, and extended at 72 C for 30 °C. This was followed by an incubation at 72 °C for 10 min for a final extension. Assembly products were verified for size via agarose gel electrophoresis and subsequently purified using Agencourt RNAClean XP beads. Purified DNA was quantified via NanoDrop (Thermo Scientific) and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 and quantified via NanoDrop. The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.04.14.041962 doi: bioRxiv preprint NaCl, 1.5 μL of oligo-dT Poly(A)Purist MAG beads (Ambion), and 0.065 pmol of 5' Fluorescein (FAM)-labeled Tail2-A20 primer were added (sequence in Table S1 ), and the solution was mixed and incubated for 15 minutes. The magnetic beads were then pulled down by placing the mixture on a 96-post magnetic stand, washed twice with 100 μL of 70% EtOH, and air dried for 10 minutes before being resuspended in 2.5 μL RNase free H2O.

    Search related documents:
    Co phrase search for related documents