Selected article for: "complementary sequence and srna seq"

Author: Chang Liu; Ze Chen; Wenyuan Shen; Deshui Yu; Siyu Li; Yue Hu; Haishuo Ji; Wenjun Bu; Qingsong Wang; Shan Gao
Title: Complemented palindrome small RNAs first discovered from SARS coronavirus
  • Document date: 2017_9_7
  • ID: g55d5ijx_10
    Snippet: One typical cpsRNA UCUUUAACAAGCUUGUUAAAGA (DQ497008: 25962-25983) located in the 119 orf3b gene on the SARS-CoV strain MA15 genome was detected in four runs of sRNA-seq data (SRA: 120 SRR452404, SRR452406, SRR452408 and SRR452410). This cpsRNA was named SARS-CoV-cpsR-22, 121 which contained 22 nucleotides perfectly matching its reverse complementary sequence (Figure 2A) . We 122 also detected one 18-nt and one 19-nt segment of SARS-CoV-cpsR-22, w.....
    Document: One typical cpsRNA UCUUUAACAAGCUUGUUAAAGA (DQ497008: 25962-25983) located in the 119 orf3b gene on the SARS-CoV strain MA15 genome was detected in four runs of sRNA-seq data (SRA: 120 SRR452404, SRR452406, SRR452408 and SRR452410). This cpsRNA was named SARS-CoV-cpsR-22, 121 which contained 22 nucleotides perfectly matching its reverse complementary sequence (Figure 2A) . We 122 also detected one 18-nt and one 19-nt segment of SARS-CoV-cpsR-22, which could also be derived from 123 siRNA duplexes ( Figure 2B ) but their strands (positive or negative) could not be determined. Among 124 SARS-CoV-cpsR-22 and its two segments, the 19-nt segment was the most abundant and the 22-nt SARS-125

    Search related documents:
    Co phrase search for related documents
    • complementary sequence and SARS CoV segment: 1
    • complementary sequence and srna seq: 1, 2
    • reverse complementary sequence and SARS CoV segment: 1
    • reverse complementary sequence and srna seq: 1, 2
    • SARS CoV strain and srna seq: 1