Selected article for: "RNA virus detection and virus detection"

Author: Chang Liu; Ze Chen; Wenyuan Shen; Deshui Yu; Siyu Li; Yue Hu; Haishuo Ji; Wenjun Bu; Qingsong Wang; Shan Gao
Title: Complemented palindrome small RNAs first discovered from SARS coronavirus
  • Document date: 2017_9_7
  • ID: g55d5ijx_2
    Snippet: The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Small RNA sequencing (small RNA-seq or sRNA-seq) is used to acquire thousands of short RNA 58 sequences with lengths of usually less than 50 bp. With sRNA-seq, many novel non-coding RNAs (ncRNAs) 59 have been discovered. For example, two featured series of rRNA-derived RNA fragm.....
    Document: The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Small RNA sequencing (small RNA-seq or sRNA-seq) is used to acquire thousands of short RNA 58 sequences with lengths of usually less than 50 bp. With sRNA-seq, many novel non-coding RNAs (ncRNAs) 59 have been discovered. For example, two featured series of rRNA-derived RNA fragments (rRFs) constitute a 60 novel class of small RNAs [1] . Small RNA-seq has also been used for virus detection in plants [2] [3] [4] and 61

    Search related documents:
    Co phrase search for related documents
    • complementary sequence and reverse complementary sequence: 1, 2, 3, 4, 5, 6, 7, 8
    • complementary sequence and RNA fragment: 1
    • complementary sequence and RNA seq: 1
    • complementary sequence and small rna: 1, 2, 3
    • complementary sequence and small RNA seq: 1
    • complementary sequence and srna seq: 1, 2
    • complementary sequence and virus detection: 1, 2, 3, 4
    • ncRNAs non coding rna and non coding rna: 1, 2
    • non coding rna and RNA seq: 1, 2, 3, 4, 5, 6, 7
    • non coding rna and small rna: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28
    • novel class and reverse complementary sequence: 1
    • novel class and RNA seq: 1, 2
    • novel class and small rna: 1, 2
    • reverse complementary sequence and RNA seq: 1
    • reverse complementary sequence and small rna: 1
    • reverse complementary sequence and small RNA seq: 1
    • reverse complementary sequence and srna seq: 1, 2